Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Clone ID: 22790

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

< back    next >

3 rows shown out of 3 rows returned (100.00% out of 3 total in table)

clone ID: 22790
GB AccNum: BX105250
GB GI: 27833427
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 433
Quality Seq Start: 1
Quality Seq Stop: 433
Longest Non Repeat: 0
GB Date Created: 2003-02-06 00:00:00
Sequence Modification Date: 2005-04-11 19:07:00
Is Active: 1
||
clone ID: 22790
GB AccNum: R38636
GB GI: 796092
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 504
Quality Seq Start: 1
Quality Seq Stop: 384
Longest Non Repeat: 0
GB Date Created: 1995-05-04 00:00:00
Sequence Modification Date: 2005-04-14 20:59:00
Is Active: 1
||
clone ID: 22790
GB AccNum: T75241
GB GI: 692003
tigrID:
endedness: 5
Is Low Quality: 0
Is Reversed: 0
Seq Length: 439
Quality Seq Start: 1
Quality Seq Stop: 398
Longest Non Repeat: 0
GB Date Created: 1995-03-03 00:00:00
Sequence Modification Date: 2005-04-14 22:24:00
Is Active: 1
||

3 rows shown out of 3 rows returned (100.00% out of 3 total in table)

seq:
ttttttttttttttanctggtacaaaatctttatgtaagtataaaataaataatatgaatattaattaataacaacaaca
caacagcggcaacaatattaataataacaagagctctcccattggcccacggccttcctccagcttttctcttctgcttc
acacaactttgtgagatagctgttttcatagctgggaaaactgaggcccagagaggtcggcacactggcctgaggtcaca
cagcaagtctgtagggctgggagccgagggaagggcaaaggggtcccccggatccagccagggcagagagggggatttca
ggtttaggtccagaggagagtgcctccccacagtctggcagncattancagggtgatggtgaggctgaaatgggcagggc
caggctgaggagcagcccactggggtactggac

masked seq:
TTTTTTTTTTTTTTANCTGGTACAAAATCTTTATGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTCTCCCATTGGCCCACGGCCTTCCTCCAGCTTTTCTCTTCTGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAAGGGCAAAGGGGTCCCCCGGATCCAGCCAGGGCAGAGAGGGGGATTTCA
GGTTTAGGTCCAGAGGAGAGTGCCTCCCCACAGTCTGGCAGNCATTANCAGGGTGATGGTGAGGCTGAAATGGGCAGGGC
CAGGCTGAGGAGCAGCCCACTGGGGTACTGGAC

||
seq:
ttttttttttcactggtacaaaatctttatgtaagtataaaataaataatatgaatattaattaataacaacaacacaac
agcggcaacaatattaataataacaagagctctcccattggcccacgctntcctccagcttttctcttctgcttcacaca
actttgtgagatagctgttttcatagctgggaaaactgaggcccagagaggtcggcacactggcctgaggtcacacagca
agtctgtagggctgggagccgagggaagggcaaaggggtcccccggatccagccagggcagagagggggatttcaggttt
aggtccagaggagagtgcctccccacagtntggcagtcattagcagggtgatggtgaggctgagatggggcagggcaggg
nttaggagcagccccacttgcggtacttngacatncagggtcttgggttggttacagccactttttagtnccagcaggag
acattcattttggttcatncttta

masked seq:
TTTTTTTTTTCACTGGTACAAAATCTTTATGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTCTCCCATTGGCCCACGCTNTCCTCCAGCTTTTCTCTTCTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGGAAGGGCAAAGGGGTCCCCCGGATCCAGCCAGGGCAGAGAGGGGGATTTCAGGTTT
AGGTCCAGAGGAGAGTGCCTCCCCACAGTNTGGCAGTCATTAGCAGGGTGATGGTGAGGCTGAGATGGGGCAGGGCAGGG
NTTAGGAGCAGCCCCACTTGCGGTACTTNGACATNCAGGGTCTTGGGTTGGTTACAGCCACTTTTTAGTNCCAGCAGGAG
ACATTCATTTTGGTTCATNCTTTA

||
seq:
agcgcaggggaccccgcgcacaggagctgccctcgcgacatgggcaccgccgctgctncgctgctctgctnctccacacc
tgcgtccagcctcttgggnctgcggtcatgcagtgtaagccaacggggattgccgtgtggaagagtgcgccctgggacag
acctctgcaggaccacgatcgtgcgcttgtgggaagaaggagaagagctggagctggtggagaaaagctgtacccactca
gagaagaccaacaggaccctgagctatcggactggcttgaagatcaccagccttaccgaggttgtgtgtgggttagactt
gtgcaaccagggcaactctggccgggctgtcacctattcccgaagccgttaactcgaatgcatttcctgttggctcatca
gacatgagctngtgagaggggccnggcancagagcctgc

masked seq:
AGCGCAGGGGACCCCGCGCACAGGAGCTGCCCTCGCGACATGGGCACCGCCGCTGCTNCGCTGCTCTGCTNCTCCACACC
TGCGTCCAGCCTCTTGGGNCTGCGGTCATGCAGTGTAAGCCAACGGGGATTGCCGTGTGGAAGAGTGCGCCCTGGGACAG
ACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCA
GAGAAGACCAACAGGACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTT
GTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTAACTCGAATGCATTTCCTGTTGGCTCATCA
GACATGAGCTNGTGAGAGGGGCCNGGCANCAGAGCCTGC

||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1686443
clone ID: 22790
row: o
column: 9
parent well ID:
plate ID: 4422
Plate Number: 72
plate geometry ID: 2
actual num clones: 380
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||

Problems

Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4422
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||

External Refs


horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu