Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Clone ID: 23876

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

< back    next >

3 rows shown out of 3 rows returned (100.00% out of 3 total in table)

clone ID: 23876
GB AccNum: R38284
GB GI: 795740
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 564
Quality Seq Start: 1
Quality Seq Stop: 354
Longest Non Repeat: 0
GB Date Created: 1995-05-04 00:00:00
Sequence Modification Date: 2005-04-14 20:59:00
Is Active: 1
||
clone ID: 23876
GB AccNum: T77121
GB GI: 694324
tigrID:
endedness: 5
Is Low Quality: 0
Is Reversed: 0
Seq Length: 453
Quality Seq Start: 1
Quality Seq Stop: 384
Longest Non Repeat: 0
GB Date Created: 1995-03-06 00:00:00
Sequence Modification Date: 2005-04-14 23:21:00
Is Active: 1
||
clone ID: 23876
GB AccNum: AF035301
GB GI: 2661059
tigrID:
endedness: F
Is Low Quality: 0
Is Reversed: 0
Seq Length: 1365
Quality Seq Start: 1
Quality Seq Stop: 1365
Longest Non Repeat: 0
GB Date Created: 2000-07-07 00:00:00
Sequence Modification Date: 2009-12-17 12:59:00
Is Active: 1
||

3 rows shown out of 3 rows returned (100.00% out of 3 total in table)

seq:
ttttttttcagtgtgcaacgttttcatttaatttttaaataatttatatccctctgaaacaaaaccctgaaggctcaggt
acatcatctgaaggttctcttaaataagangagttggtacaaggacaccggagaaggccgggacgcctggatcggtaagt
gctgaagatgctgaggctgtggggcagctttcccgggacagccacgtgggagagccagctcacctggtccccacggtgag
gcgcaacaaggaggggctggcacaggcaggcacctttataagccagagagaggttcacaggccagaaagaggttcccccc
agctcacaggagccccgtngttaggaggagggggaacacttcagtcaccagcagacagaaggaaagtggccccagatctt
gccacattgggacgtncaagccaaacggcacttccttcttcctgctttagcgcatttcgagtntttttttcctgtttcct
nttaagnacctnattcttacgggtttagttggcagttccagaatttggaggantatttnagttttaggctgggttttttc
aggg

masked seq:
TTTTTTTTCAGTGTGCAACGTTTTCNNNNNNNNNNNNNNNNNNNNNNNNCCCTCTGAAACAAAACCCTGAAGGCTCAGGT
ACATCATCTGAAGGTTCTCTTAAATAAGANGAGTTGGTACAAGGACACCGGAGAAGGCCGGGACGCCTGGATCGGTAAGT
GCTGAAGATGCTGAGGCTGTGGGGCAGCTTTCCCGGGACAGCCACGTGGGAGAGCCAGCTCACCTGGTCCCCACGGTGAG
GCGCAACAAGGAGGGGCTGGCACAGGCAGGCACCTTTATAAGCCAGAGAGAGGTTCACAGGCCAGAAAGAGGTTCCCCCC
AGCTCACAGGAGCCCCGTNGTTAGGAGGAGGGGGAACACTTCAGTCACCAGCAGACAGAAGGAAAGTGGCCCCAGATCTT
GCCACATTGGGACGTNCAAGCCAAACGGCACTTCCTTCTTCCTGCTTTAGCGCATTTCGAGTNTTTTTTTCCTGTTTCCT
NTTAAGNACCTNATTCTTACGGGTTTAGTTGGCAGTTCCAGAATTTGGAGGANTATTTNAGTTTTAGGCTGGGTTTTTTC
AGGG

||
seq:
cttcattgatnattgaattctgaagcgatacgaccagcacatgggtggcgtttgaaagggncatccagagccatgggnnc
gagaggaattcactncccaaacctttgttgagcagctactgtatgccacgctttgtgctagaggacaggactgatgccac
ccctgcccccaggacttgacagggtagcagagggaagacacatgagctgctttttaattttttttagaattaatagagac
ggggtctcactctgtcactatgttgcccaggctagttttgaactcctggccgcaagcagtcctcctacctcagcttccca
aaatgctgggattacaggtgtgagccaccgtgcttagccatgaattgattttaaaaccttaaatgaggggccaggtgttg
tctttccgtttgcctgagtgacgcgggtcttntccagggcatccngccacaga

masked seq:
CTTCATTGATNATTGAATTCTGAAGCGATACGACCAGCACATGGGTGGCGTTTGAAAGGGNCATCCAGAGCCATGGGNNC
GAGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGACAGGACTGATGCCAC
CCCTGCCCCCAGGACTTGACAGGGTAGCAGAGGGAAGACACATGAGCTGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGAATTGATTTTAAAACCTTAAATGAGGGGCCAGGTGTTG
TCTTTCCGTTTGCCTGAGTGACGCGGGTCTTNTCCAGGGCATCCNGCCACAGA

||
seq:
acttcatgaacacggacaatttcacctcccaccgtctcccccacccctggtcgggcacggggcaggtggtctacaacggt
tctatctactttaacaagttccagagccacatcatcatcaggtttgacctgaagacagagaccatcctcaagacccgcag
cctggactatgccggttacaacaacatgtaccactacgcctggggtggccactcggacatcgacctcatggtggacgaga
gcgggctgtgggccgtgtacgccaccaaccagaacgctggcaacatcgtggtcagtaggctggaccccgtgtccctgcag
accctgcagacctggaacacgagctaccccaagcgcagcgccggggaggccttcatcatctgcggcacgctgtacgtcac
caacggctactcagggggtaccaaggtccactatgcataccagaccaatgcctccacctatgaatacatcgacatcccat
tccagaacaaatactcccacatctccatgctggactacaaccccaaggaccgggccctgtatgcctggaacaacggccac
cagatcctctacaacgtgaccctcttccacgtcatccgctccgacgagttgtagctccctcctcctggaagccaagggcc
cacgtcctcaccacaaagggactcctgtgaaactgctgccaaaaagataccaataacactaacaataccgatcttgaaaa
atcatcagcagtgcggattctgacatcgagggatggcattacctccgtgtttctccctttcgagccggcgggccacagac
gtcggaagaaactcccgtatttgcagctggaactgcagcccacggcgccccggttttcctccccgccctgtccctctctg
gtcaaacaacatactaaagaggcgaggcaatgactgttggccagttctcaccggggaaaaacccactgttaggatggcat
gaacatttccttagatcgtggtcagctccgaggaatgtggcgtccaggctctttgagagccatgggctgcacccggccgt
aggctagtgtaactcgcatcccattgcagtgccgtttcttgactgtgttgctgtctcttagattaaccgtgctgaggctc
cacatagctcctggacctgtgtctagtacatactgaagcgatggtcagagtgtgtagagtgaagttgctgtgcccacatt
gtttgaactcgcgtaccccgtagatacattgtgcaacgttcttctgttattcccttgaggtggtaacttcgtatgttcag
tttatgcgatgattgttgtaaatgcaatgccgtagtttggattaataagtggatggtttttgtttctaaaaaaaaaaaaa
aaaaa

masked seq:
ACTTCATGAACACGGACAATTTCACCTCCCACCGTCTCCCCCACCCCTGGTCGGGCACGGGGCAGGTGGTCTACAACGGT
TCTATCTACTTTAACAAGTTCCAGAGCCACATCATCATCAGGTTTGACCTGAAGACAGAGACCATCCTCAAGACCCGCAG
CCTGGACTATGCCGGTTACAACAACATGTACCACTACGCCTGGGGTGGCCACTCGGACATCGACCTCATGGTGGACGAGA
GCGGGCTGTGGGCCGTGTACGCCACCAACCAGAACGCTGGCAACATCGTGGTCAGTAGGCTGGACCCCGTGTCCCTGCAG
ACCCTGCAGACCTGGAACACGAGCTACCCCAAGCGCAGCGCCGGGGAGGCCTTCATCATCTGCGGCACGCTGTACGTCAC
CAACGGCTACTCAGGGGGTACCAAGGTCCACTATGCATACCAGACCAATGCCTCCACCTATGAATACATCGACATCCCAT
TCCAGAACAAATACTCCCACATCTCCATGCTGGACTACAACCCCAAGGACCGGGCCCTGTATGCCTGGAACAACGGCCAC
CAGATCCTCTACAACGTGACCCTCTTCCACGTCATCCGCTCCGACGAGTTGTAGCTCCCTCCTCCTGGAAGCCAAGGGCC
CACGTCCTCACCACAAAGGGACTCCTGTGAAACTGCTGCCAAAAAGATACCAATAACACTAACAATACCGATCTTGAAAA
ATCATCAGCAGTGCGGATTCTGACATCGAGGGATGGCATTACCTCCGTGTTTCTCCCTTTCGAGCCGGCGGGCCACAGAC
GTCGGAAGAAACTCCCGTATTTGCAGCTGGAACTGCAGCCCACGGCGCCCCGGTTTTCCTCCCCGCCCTGTCCCTCTCTG
GTCAAACAACATACTAAAGAGGCGAGGCAATGACTGTTGGCCAGTTCTCACCGGGGAAAAACCCACTGTTAGGATGGCAT
GAACATTTCCTTAGATCGTGGTCAGCTCCGAGGAATGTGGCGTCCAGGCTCTTTGAGAGCCATGGGCTGCACCCGGCCGT
AGGCTAGTGTAACTCGCATCCCATTGCAGTGCCGTTTCTTGACTGTGTTGCTGTCTCTTAGATTAACCGTGCTGAGGCTC
CACATAGCTCCTGGACCTGTGTCTAGTACATACTGAAGCGATGGTCAGAGTGTGTAGAGTGAAGTTGCTGTGCCCACATT
GTTTGAACTCGCGTACCCCGTAGATACATTGTGCAACGTTCTTCTGTTATTCCCTTGAGGTGGTAACTTCGTATGTTCAG
TTTATGCGATGATTGTTGTAAATGCAATGCCGTAGTTTGGATTAATAAGTGGATGGTTTTTGTTTCTAAAAAAAAAAAAA
AAAAA

||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1687528
clone ID: 23876
row: b
column: 22
parent well ID:
plate ID: 4424
Plate Number: 74
plate geometry ID: 2
actual num clones: 383
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||

Problems

Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4424
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||

External Refs


horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu