 | I.M.A.G.E. Consortium | “Sharing resources to achieve a common goal — the discovery of all genes” |

Clone ID: 26182
< back next >
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
clone ID: 26182
GB AccNum: R38431
GB GI: 795887
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 231
Quality Seq Start: 1
Quality Seq Stop: 203
Longest Non Repeat: 0
GB Date Created: 1995-05-04 00:00:00
Sequence Modification Date: 2005-04-14 20:59:00
Is Active: 1
||
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
seq:
tttttttttttttcttttatatacatangtttattcctccccagccccagacaatgccccaggacactttataggggcat
ggagatgcactaccctgtctctcagaagctgggtctctggagaccgggatggggagaagggggaagccctatgcaagacg
cagctccccctcagcctcagcgccccccccgcagagaggggacataganggaaaaaggaaggtgacacaag
masked seq:
TTTTTTTTTTTTTCTTTTATATACATANGTTTATTCCTCCCCAGCCCCAGACAATGCCCCAGGACACTTTATAGGGGCAT
GGAGATGCACTACCCTGTCTCTCAGAAGCTGGGTCTCTGGAGACCGGGATGGGGAGAAGGGGGAAGCCCTATGCAAGACG
CAGCTCCCCCTCAGCCTCAGCGCCCCCCCCGCAGAGAGGGGACATAGANGGAAAAAGGAAGGTGACACAAG
||
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
Well ID: 1689833
clone ID: 26182
row: k
column: 19
parent well ID:
plate ID: 4430
Plate Number: 139
plate geometry ID: 2
actual num clones: 375
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||
Problems
Distributed Plates
1 row shown out of 1 rows returned (100.00% out of 1 total in table)
plate ID: 4430
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42
||
External Refs
