Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Clone ID: 30420

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

< back    next >

2 rows shown out of 2 rows returned (100.00% out of 2 total in table)

clone ID: 30420
GB AccNum: R18157
GB GI: 771767
endedness: 5
Is Low Quality: 0
Is Reversed: 0
Seq Length: 426
Quality Seq Start: 1
Quality Seq Stop: 343
Longest Non Repeat: 0
GB Date Created: 1995-04-14 00:00:00
Sequence Modification Date: 2005-04-14 19:55:00
Is Active: 1
clone ID: 30420
GB AccNum: R41704
GB GI: 799928
endedness: 3
Is Low Quality: 1
Is Reversed: 0
Seq Length: 62
Quality Seq Start: 1
Quality Seq Stop: 1
Longest Non Repeat: 0
GB Date Created: 1995-05-22 00:00:00
Sequence Modification Date: 2005-04-14 20:59:00
Is Active: 1

2 rows shown out of 2 rows returned (100.00% out of 2 total in table)


masked seq:

seq: gtcttaaaaaagaacaatccagtgttgcagttcagagaggttagcatgtcagggcgcaggct

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1694071
clone ID: 30420
row: g
column: 17
parent well ID:
plate ID: 4440
Plate Number: 149
plate geometry ID: 2
actual num clones: 384
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin


Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4440
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:42
Distributed Plate Modification Date: 2005-11-07 10:28:42

External Refs

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to