Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Clone ID: 52202

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

< back    next >

2 rows shown out of 2 rows returned (100.00% out of 2 total in table)

clone ID: 52202
GB AccNum: H24378
GB GI: 893073
tigrID:
endedness: 3
Is Low Quality: 0
Is Reversed: 0
Seq Length: 178
Quality Seq Start: 1
Quality Seq Stop: 108
Longest Non Repeat: 0
GB Date Created: 1995-07-06 00:00:00
Sequence Modification Date: 2005-04-14 17:13:00
Is Active: 1
||
clone ID: 52202
GB AccNum: H25196
GB GI: 894319
tigrID:
endedness: 5
Is Low Quality: 1
Is Reversed: 0
Seq Length: 67
Quality Seq Start: 1
Quality Seq Stop: 1
Longest Non Repeat: 0
GB Date Created: 1995-07-10 00:00:00
Sequence Modification Date: 2005-04-14 17:14:00
Is Active: 1
||

2 rows shown out of 2 rows returned (100.00% out of 2 total in table)

seq:
tttttttttttcaggtttcaaccgtttttattgggaggttttgttttctgtgaaatacactagagggtngggaaggggac
acattcactttgcaagataagggtttcccaccactaaaggnaaggcatggggcagggnacactgggagtttagntccgtt
ttcccacctccttctgct

masked seq:
TTTTTTTTTTTCAGGTTTCAACCGTTTTTATTGGGAGGTTTTGTTTTCTGTGAAATACACTAGAGGGTNGGGAAGGGGAC
ACATTCACTTTGCAAGATAAGGGTTTCCCACCACTAAAGGNAAGGCATGGGGCAGGGNACACTGGGAGTTTAGNTCCGTT
TTCCCACCTCCTTCTGCT

||
seq: ggacgaggaatacgatgtgatcgtgctggggaccggtctcaccnaatgcatcctgtcgggcatcatg
masked seq: GGACGAGGAATACGATGTGATCGTGCTGGGGACCGGTCTCACCNAATGCATCCTGTCGGGCATCATG
||

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

Well ID: 1715827
clone ID: 52202
row: k
column: 7
parent well ID:
plate ID: 4409
Plate Number: 287
plate geometry ID: 2
actual num clones: 384
Plate Comments:
clone collection ID: 1
Clone Collection: LLAM
Clone Collection Description: production 384-well plates, ampicillin-resistant, sent to distributors, all species
data source: none
plate source: LLNL
date attained: 1994-11-17 00:00:00
date verified: 0000-00-00 00:00:00
who seq verified:
Clone Collection Comments: ongoing
Antibiotic: ampicillin
||

Problems

Distributed Plates

1 row shown out of 1 rows returned (100.00% out of 1 total in table)

plate ID: 4409
flags: 31
Is Available: 1
Distributed Plate Comments:
Distributed Plate Entry Date: 2005-11-07 10:28:43
Distributed Plate Modification Date: 2005-11-07 10:28:43
||

External Refs


horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu