Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

Primers

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |
ABI Dye Primers
M13 reverse5'-CAGGAAACAGCTATGACC-3'a.k.a.: M13 Reverse Dye Primer
M13(-21)5'-TGTAAAACGACGGCCAGT-3'a.k.a.: -21M13 Dye Primer; -21M13 universal primer
sp65'-ATTTAGGTGACACTATAG-3'a.k.a.: SP6; SP6 Dye Primer
t35'-ATTAACCCTCACTAAAGGGA-3'a.k.a.: T3; T3 Dye Primer
t75'-TAATACGACTCACTATAGGG-3'a.k.a.: T7; T7 Dye Primer
Amersham DYEnamic ET primers
-21 M13 forward5'-S+SSSSSTGTAAAACGACGGCCAGT-3'
-28 M13 reverse5'-AGGAAACAGCTATGACCAT-3'
-28 M13 reverse 25'-AGGAAACAGCTATGACATG-3'
-29 M13 reverse5'-SSSSSST^CAGGAAACAGCTATGACC-3'
-40 M13 forward5'-GTTTTCCCAGTCACGACG-3'
PolyT(N)5'-TTTTTTTTTTTTTTTTTTTTTTT(a,c,g)-3'
sp65'-ATTTAGGTGACACTATAG-3'a.k.a.: SP6; SP6 Dye Primer
t35'-ATTAACCCTCACTAAAGGGA-3'a.k.a.: T3; T3 Dye Primer
t75'-TAATACGACTCACTATAGGG-3'a.k.a.: T7; T7 Dye Primer
Custom primers from Invitrogen
-100RP5'-ATGCAGCTGGCACGACAGGT-3'
-100UP5'-CGCTATTACGCCAGCTGGCGA-3'
-21UP5'-TGTAAACGACGGCCACT-3'
-40RP5'-GGATAACAATTTCACACAGG-3'
pUC/M13 Forward(-40)5'-GTTTTCCCAGTCACGAC-3'a.k.a.: -40UP
Promega Dye Primers
M13(-21)5'-TGTAAAACGACGGCCAGT-3'a.k.a.: -21M13 Dye Primer; -21M13 universal primer
pUC/M13 Forward(-40)5'-GTTTTCCCAGTCACGAC-3'a.k.a.: -40UP
pUC/M13 reverse primer5'-CAGGAAACAGCTATGAC-3'
Sugano mouse custom primers
3' end sequencing primer5'-CGACCTGCAGCTCGAGCACA-3'
5' end sequencing primer5'-CTTCTGCTCTAAAAGCTGCG-3'
Track2
AG189(rev) 5'-CTTTATTTGTGAAATTTGTGATGC-3'
AG195(forward): 5'-CATACGATTTAGGTGACACTATAG-3'
custom
custom t7
M13 -20GTAAAACGACGGCCAGT
M13 reverse5'-CAGGAAACAGCTATGACC-3'a.k.a.: M13 Reverse Dye Primer
M13(-21)5'-TGTAAAACGACGGCCAGT-3'a.k.a.: -21M13 Dye Primer; -21M13 universal primer
M13F5-GTAAAACGACGGCCAGT-3
pDONR201-forwardTCGCGTTAACGCTAGCATGGATCTC
pDONR201-reverseGTAACATCAGAGATTTTGAGACAC
pET Upstream Primer5'-ATGCGTCCGGCGTAGA-3'
pSMART-1777FGATCCTTTGATTTTCTACCGAAG
pSMART-200RCTTACGTGCCGATCAAGTCA
sp65'-ATTTAGGTGACACTATAG-3'a.k.a.: SP6; SP6 Dye Primer
t35'-ATTAACCCTCACTAAAGGGA-3'a.k.a.: T3; T3 Dye Primer
t75'-TAATACGACTCACTATAGGG-3'a.k.a.: T7; T7 Dye Primer
T7 Rev5'-GCTAGTTATTGCTCAGCGG-3'
T7 Terminator Primer5'-GCTAGTTATTGCTCAGCGG-3'
University of Iowa pYX custom primers
pYX-3 (3' end)5'-ACTCATACTCTTCCTTTTTCAAT-3'
pYX-7 (5' end)5'-TTGCTCACATGTTAATACGAC-3'
University of Tokyo Fugu custom primers
U. of Tokyo Fugu custom 5' end sequencing primer5'-CGCTCTAGAACTAGTGGATCCA-3'

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu