Notice: Undefined variable: vectorID_where_clause in /var/www/html/image/main_image.php on line 1475 Vectors
Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line


Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

1. Lafmid BA
2. pAD-GAL4
3. pAMP1
4. pAMP10
5. pBC SK+
6. pBK-CMV
7. pBluescribe (modified)
8. pBluescript (modified)
9. pBluescript II KS+
10. pBluescript II SK+
11. pBluescript KS+
12. pBluescript SK+
13. pBluescript SK-
14. pBluescript-FL
15. pBluescriptR
16. pBSRN3
17. pCDNA3
18. pcDNA3.1
19. pcDNA3.1(-)
20. pcDNA3.1Zeo
21. pcDNAI
23. pCI-neo (updated)
28. pCMV-SPORT6.1
29. pCMV-SPORT6.ccdb
30. pCR-BluntII-TOPO
32. pCR2.1-TOPO
33. pCR3.1
34. pCR4-TOPO
35. pCR4Blunt-TOPO
36. pCS105
37. pCS107
38. pCS108
39. pCS111
40. pCS2+
41. pCS22+
42. pCS2G
43. pDeliver1.1
44. pDNR-Dual
45. pDNR-LIB
46. pDNR-NCI
47. pDONR201
48. pDONR223
50. pENTR201
51. pENTR221
52. pENTR223
53. pENTR223.1
54. pENTR223.1-LC
55. pENTR223.1-Sfi
56. pET-28a
57. pET-28b
58. pExpress-1
59. pFLC1
60. pGA1
61. pGA14
62. pGA15
63. pGA18
64. pGA19
65. pGA24
66. pGA4
67. pGA7
68. pGH
69. pMA
70. pME18S-FL3
71. pMK
72. pMK-U
73. pOTB7
74. pOTB7-3
75. pOTB7a
76. pPCR-Script Amp SK(+)
77. pRKW2
79. pSPORT1
80. pSPORT2
81. pT7T3D-PacI
82. pUC19
83. pUC19-Cam
84. pUC19-Kan
85. pUC19-Sfi
86. pUC57
87. pYX-Asc
88. pZERO-2
89. pZL-1

Note: The sequencing primers listed below for each vector are not exhaustive (only the most commonly used primers have been checked, -21M13, M13 reverse, t7, t3, and sp6) and others not listed may also be suitable. We also recommend that you check the exact sequence of your primer against the vector sequence to ensure that it matches, as there are often several slightly different versions of these common primers. When custom primers are required, their sequences are listed.

Lafmid BA

Name: Lafmid BA
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: phagemid
Vector Map: Available Here
Comments: FLANKING PCR PRIMERS: ab1: gaattgtgagcggataac ab2: gttttcccagtcacgacg or dm1: agctatgaccatgattacgcca dm2: gacggccagtgaattcccct. Annealing Temp: 55C
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pAD-GAL4
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Polylinker Sequence:


Name: pAMP1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pAMP10
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pBC SK+
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pBK-CMV
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Stratagene
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:

pBluescribe (modified)

Name: pBluescribe (modified)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Jackson Laboratory
Vector type: phagemid
Vector Map: Available Here
Comments: Stratagene vector modified by Knowles/Solter (Jackson Laboratory): original EcoRI site changed to MluI, original HindIII site changed to SalI.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:
' end of insert (Knowles/Solter
libraries).........3' end of

Full Sequence:

pBluescript (modified)

Name: pBluescript (modified)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCLA/Lin
Vector type: phagemid
Comments: custom modification from original Stratagene vector
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

pBluescript II KS+

Name: pBluescript II KS+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:

pBluescript II SK+

Name: pBluescript II SK+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:

pBluescript KS+

Name: pBluescript KS+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:

pBluescript SK+

Name: pBluescript SK+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:

pBluescript SK-

Name: pBluescript SK-
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pBluescript-FL
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: University of Tokyo/Sugano lab
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: NOTE [previously located in "full_seq" table]: the polylinker sequence above replaces the following sequence in pBluescript: actagtggatcccccgggctgcag
Sequencing Primers: t7, t3
Polylinker Sequence:
Full Sequence:


Name: pBluescriptR
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Brownstein
Vector type: phagemid
Vector Map: Available Here
Comments: modified pBluescript from Riken.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pBSRN3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Wellcome Trust
Vector type: plasmid
Has Custom Primer: yes
Comments: modified pBluescript KS+, REFERENCE: Lemaire, et al., Cell (1995) 81(1)85-94.
Polylinker Sequence:


Name: pCDNA3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Name: pcDNA3.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Sequencing Primers: t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pcDNA3.1(-)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, t7
Polylinker Sequence:

Full Sequence:


Name: pcDNA3.1Zeo
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, t7
Polylinker Sequence:

Full Sequence:


Name: pcDNAI
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: t7, sp6
Polylinker Sequence:

Full Sequence:


Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:

pCI-neo (updated)

Name: pCI-neo (updated)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: McArdle Laboratory for Cancer Research
Vector type: plasmid
Has Custom Primer: yes
Sequencing Primers: t3, custom t7
Polylinker Sequence:


Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: t7, sp6
Polylinker Sequence:
gcttgggcccctcgagggatcctctagagcggccgc{3' - cDNA
insert -
gtccggagg{CMV Promoter}

Full Sequence:


Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gatcctctagagcggccgc{3' - cDNA insert -
tcc{CMV Promoter}

Full Sequence:


Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gatcctctagagcggccgc{3' - cDNA insert -
tcc{CMV Promoter}

Full Sequence:


Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: An MluI site is introduced upon ligation of a cDNA insert.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pCMV-SPORT6.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: also known as pCMV-SPORT6.1.ccdb
Sequencing Primers: M13(-21), M13 reverse, sp6
Polylinker Sequence:

Full Sequence:


Name: pCMV-SPORT6.ccdb
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Comments: for microquantity libraries
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pCR-BluntII-TOPO
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: this vector has both kanamycin and zeocin resistance
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:

Full Sequence:


Name: pCR2.1-TOPO
Antibiotic: ampicillin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: PCR cloning vector, cloning site between the EcoRI sites (capitalized) as follows: GAATTCgccctt--cDNA INSERT--agggcGAATTC.
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:

Full Sequence:


Name: pCR3.1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Name: pCR4-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: this vector has both ampicillin and kanamycin-resistance
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pCR4Blunt-TOPO
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: This vector has both kanamycin and ampicillin resistance
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pCS105
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: vector size 4.1 kb
Polylinker Sequence:

Full Sequence:


Name: pCS107
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: vector size 4.1 kb
Sequencing Primers: t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pCS108
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: t7, t3, sp6
Polylinker Sequence:

Full Sequence:


Name: pCS111
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Comments: Mustafa Khokha modified pCS108 by cloning a linker between the EcoRI and NotI sites eliminating the SfiI site and creating a SmaI site. This creates a vector suitable for cloning cDNAs using the methods from the XGC.
Sequencing Primers: t7, t3, sp6
Polylinker Sequence:


Name: pCS2+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Max Planck Institute/Rupp
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: Expression vector, T7 may be mutated. NOTES: Vector size 4095 bp. pCS2+ is an expression vector primarily designed for expressing proteins in Xenopus embryos from either injected RNA or DNA, pCS2+ is also useful for high-level transient expression in a wide variety of mammalian and avian cells. It is also functional in zebrafish embryos (as DNA or RNA) and it can be used for invitro transcription/translation. pCS2+ contains a strong enhancer/promoter (simian CMV 1E94) followed by a polylinker and the SV40 late polyadenylation site. An sp6 promoter is present in the 5' UTR, allowing in vitro RNA synthesis of sequences cloned into the polylinker. A T7 promoter in reverse orientation between the polylinker and the SV40 polyA site for probe synthesis, as well as a second polylinker after the SV40 polyA site provide several sites to linearize the vector for Sp6 RNA transcription. Vector backbone is pBluescript II KS+ and includes the amp gene and an f1 origin for single stranded DNA.
Sequencing Primers: t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pCS22+
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: UCBerkeley/Harland
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Name: pCS2G
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: RIKEN/Carninci
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Comments: pCS2-based expression vector
Sequencing Primers: t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pDeliver1.1
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: GeneCopoeia
Vector type: Gateway entry vector


Name: pDNR-Dual
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Clontech
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:

Full Sequence:


Name: pDNR-LIB
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Clontech
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Name: pDNR-NCI
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Clontech
Vector type: phagemid
Vector Map: Available Here
Comments: Clontech preliminary MGC vector
Polylinker Sequence:

Full Sequence:


Name: pDONR201
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Name: pDONR223
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Dana Farber Cancer Institute/Vidal Lab
Vector type: plasmid
Vector Map: Available Here
Polylinker Sequence:

Full Sequence:


Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7
Polylinker Sequence:

Full Sequence:


Name: pENTR201
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: pDONR201-forward, pDONR201-reverse
Polylinker Sequence:

Full Sequence:


Name: pENTR221
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pENTR223
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Dana Farber Cancer Institute/Vidal Lab
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:

Full Sequence:


Name: pENTR223.1
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: Gateway entry vector
Vector Map: Available Here
Sequencing Primers: M13(-21), t7
Polylinker Sequence:

Full Sequence:


Name: pENTR223.1-LC
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Blue Heron
Vector type: Gateway entry vector
Comments: The pENTR223.1-LC vector has the pBR ORI. Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13F
Polylinker Sequence:
GTACAAAAAAGCAGAAG- ggccgtcaaggcccacc(linker)-ORF-

Full Sequence:


Name: pENTR223.1-Sfi
Antibiotic: spectinomycin
Concentration: 100 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Comments: same as pENTR223.1; Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13F, T7 Rev
Polylinker Sequence:

Full Sequence:


Name: pET-28a
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Novagen
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: pET Upstream Primer, T7 Terminator Primer


Name: pET-28b
Antibiotic: kanamycin
Concentration: 10ug/ml
Source: Novagen
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: pET Upstream Primer, T7 Terminator Primer


Name: pExpress-1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Express Genomics/Gruber
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pFLC1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: RIKEN/Carninci
Vector type: phagemid
Comments: this vector is identical to pBluescriptR used by Mike Brownstein


Name: pGA1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA14
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA15
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA18
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA19
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA24
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA4
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGA7
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pGH
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: phagemid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pMA
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pME18S-FL3
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: University of Tokyo/Sugano lab
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: DraIII sites are lost in cDNA cloning and the XhoI sites should be used to isolate the cDNA insert.
Polylinker Sequence:

Full Sequence:


Name: pMK
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pMK-U
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Geneart
Vector type: plasmid
Comments: Vector Map was previously listed as being here: ; but this file was not present at time of server transfer to CPD.
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pOTB7
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: UCBerkeley/Rubin
Vector type: plasmid
Vector Map: Available Here
Comments: this vector contains the Gateway recombination cassette in the polylinker.
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pOTB7-3
Antibiotic: chloramphenicol
Concentration: 10ug/ml
Source: University of Michigan, Ann Arbor
Vector type: phagemid
Comments: Custom vector from pOTB7 parent, the POTB7 vector was modified to produce pOTB7-3 by inserting an F1 origin in the SmaI site at 358 of pOTB7, an AscI restriction site in the BglII site at 278, and the bacterial CCD killer gene flanked by BstXI restriction sites in the XhoI site at 185 (note the M13 reverse primer is lost during cloning).
Sequencing Primers: M13(-21), t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pOTB7a
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Edge Biosystems
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), t7, sp6
Polylinker Sequence:

Full Sequence:

pPCR-Script Amp SK(+)

Name: pPCR-Script Amp SK(+)
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Stratagene
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pRKW2
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: DKFZ/Niehrs
Vector type: phagemid
Has Custom Primer: yes
Vector Map: Available Here
Comments: modified from pRK5
Sequencing Primers: M13(-21), M13 reverse, AG195, AG189
Polylinker Sequence:

Full Sequence:


Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: Lucigen Corporation
Vector type: plasmid
Comments: pSMART_cDNA -- A derivative of Lucigen's pSMART vector, containing a pUC19 multiple cloning site. Vector map previously located here:
Sequencing Primers: pSMART-1777F, pSMART-200R
Polylinker Sequence:

Full Sequence:


Name: pSPORT1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:
gcggccgc{3' - cDNA insert -

Full Sequence:


Name: pSPORT2
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: phagemid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pT7T3D-PacI
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: plasmid
Vector Map: Available Here
Comments: Modified by Soares from original Pharmacia pT7T3 vector. NOTE: Washington University's trace files indicate that the "c" at 40 bp (directly before the EcoRI site) should be deleted. NOTE: Please do not contact Pharmacia with questions about this vector; it is a modified version of their original pT7T3 vector (which itself is not offered any more by Pharmacia) which they have never carried as a catalog item. If you have questions, please contact Also please note that especially in the past, this vector has been known by several aliases, including pT7T3D-Pac and pT7T3D.
Sequencing Primers: M13(-21), M13 reverse, t7, t3
Polylinker Sequence:

Full Sequence:


Name: pUC19
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: New England Biolabs
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pUC19-Cam
Antibiotic: chloramphenicol
Concentration: 25 ug/ml
Source: Takara Bio Inc.
Vector type: plasmid
Comments: Vector map previously at:
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pUC19-Kan
Antibiotic: kanamycin
Concentration: 50-200 ug/ml
Source: New England Biolabs
Vector type: plasmid
Comments: Vecor map previously at:
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pUC19-Sfi
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Codon Devices
Vector type: plasmid
Comments: pUC19-Sfi -- A pUC19 derivative with the multiple cloning site swapped with a SfiI linker. Vector map previously located at:
Sequencing Primers: M13(-21), M13 reverse
Polylinker Sequence:

Full Sequence:


Name: pUC57
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Genscript
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13 reverse, M13 -20
Full Sequence:


Name: pYX-Asc
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Columbia University/Soares
Vector type: plasmid
Has Custom Primer: yes
Vector Map: Available Here
Sequencing Primers: t7, t3, custom
Polylinker Sequence:

Full Sequence:


Name: pZERO-2
Antibiotic: kanamycin
Concentration: 25 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:


Name: pZL-1
Antibiotic: ampicillin
Concentration: 50-200 ug/ml
Source: Invitrogen Life Technologies
Vector type: plasmid
Vector Map: Available Here
Comments: pSPORT plus a single LoxP site
Sequencing Primers: M13(-21), M13 reverse, t7, sp6
Polylinker Sequence:

Full Sequence:
horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to