Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: Sugano-Kawakami DRA

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

whole body

   1. Sugano-Kawakami DRA

Sugano-Kawakami DRA

Name: Sugano-Kawakami DRA
Library ID: 1333
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: whole body
Tissue: whole body (including unfertilized eggs)
Host: GeneHogs DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer
[ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a
DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII
sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG).
XhoI should be used to isolate the cDNA insert. Size selection was
performed to exclude fragments <1.5kb. Library constructed and donated
by Dr. Sumio Sugano and Dr. Ko-ichi Kawakami (University of Tokyo Institute
of Medical Science).
Custom primers for sequencing: 5' end primer
CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.
REFERENCES:
Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano,
S. Construction and characterization of a full length-enriched and a 5' end
enriched cDNA library. Gene 200, 149-156, 1997.


horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu