Name: NIH_MGC_35 Library ID: 1409 Organism: Homo sapiens Gender: female Age: 0 Organ: cervix Tissue: carcinoma cell line Host: GeneHogs DH10B Vector: pOTB7a Vector type: plasmid Insert digest: 5' CeuI/SceI 3' Stop Codon Status: without Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 1.8kb. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.