Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_2

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

   1. NIH_MGC_2

Name: NIH_MGC_2
Library ID: 1418
Organism: Homo sapiens
Age: 0
Organ: blood
Tissue: blood from T-cell leukemia, cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 700 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to