Name: Sugano SJD adult male Library ID: 1812 Organism: Danio rerio Gender: male Age: 0 Stage: adult Organ: whole body Host: GeneHogs DH10B Vector: pME18S-FL3 Vector type: phagemid Insert digest: 5' DraIII/DraIII 3' Stop Codon Status: without Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed and donated by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.