Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: Melton normalized human islet 4 N4-HIS1

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

pancreas

   1. Melton normalized human islet 4 N4-HIS1

Melton normalized human islet 4 N4-HIS1

Name: Melton normalized human islet 4 N4-HIS1
Library ID: 1898
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Starting library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows. 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.08 kb. Library was amplified once on solid support and plasmid DNA from library was prepared. The library DNA was normalized by method #4 from Bonaldo, Lennon, and Soares (1996 Genome Research 6:791-806); 0.5 microgram single-stranded library plasmid DNA was mixed with 5 micrograms PCR product representing library inserts and hybridized to an Ecot of 20. Single-stranded (unhybridized) plasmids were isolated by hydroxyapatite chromatography and used to make this library. Library arrayed and constructed in the laboratory of D. Melton, Ph.D. (Harvard University).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu