Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: Amplified Melton mouse islets 1 MIS1-A

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

pancreas

   1. Amplified Melton mouse islets 1 MIS1-A

Amplified Melton mouse islets 1 MIS1-A

Name: Amplified Melton mouse islets 1 MIS1-A
Library ID: 1899
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 0.91 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University)

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu