Name: Melton mouse E16.5 pancreas M16Z1 Library ID: 1904 Organism: Mus musculus Strain: ICR Gender: both Age: 0 Stage: embryo Organ: pancreas Tissue: pooled Host: TOP10 Vector: pZERO-2 Vector type: plasmid Insert digest: 5' XhoI/NotI 3' Stop Codon Status: without Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation; average insert size 1.2kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).