Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: Melton mouse islets MIZ1

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library


   1. Melton mouse islets MIZ1

Melton mouse islets MIZ1

Name: Melton mouse islets MIZ1
Library ID: 1905
Organism: Mus musculus
Strain: ICR
Gender: male
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.1kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to