Name: Melton amplified mouse E16.5 pancreas3 M16S1-A Library ID: 1933 Organism: Mus musculus Strain: ICR Gender: both Age: 0 Stage: embryo Organ: pancreas Host: DH10B Vector: pSPORT1 Vector type: phagemid Insert digest: 5' SalI/NotI 3' Stop Codon Status: without Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows: 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.47 kb. Amplified once on solid support. cDNA Library Preparation: G. Chen in the laboratory of D. Melton, Ph.D. (Harvard University).