Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_135

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

limb

   1. NIH_MGC_135

NIH_MGC_135

Name: NIH_MGC_135
Library ID: 1996
Organism: Mus musculus
Age: 0
Stage: embryo
Organ: limb
Tissue: Embryonic limb, maxilla and mandible
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5. Oligo-dT primed (5''- GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)16-3''), directionally cloned, size selected for the 0.5-1 kb fragments; average insert size 1.6 kb. Normalized to Cot 7.5. Tissue contributed by David Rowe. Library constructed by ResGen, Invitrogen Corp. Note: this is a NIH_MGC Library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu