Name: NIH_MGC_222 Library ID: 2060 Organism: Mus musculus Strain: C57BL/6 Age: 0 Stage: placental Organ: placenta Tissue: pool of 3 placentas from one mouse Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1 kb resulted in an average insert size of 1.5 kb. Library is not amplified. (Normalized version of this library is NIH_MGC_203.) Library constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC Library.