Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: GISZF001

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

embryo

   1. GISZF001

GISZF001

Name: GISZF001
Library ID: 2089
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Average insert size 2 kb. For PCR insert analysis use forward and reverse primers. Library amplified recombinants (inserts): 98%; library complexity:5x10E6; full-length construction method: SMART (Clontech). Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu