Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_220

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

mixed

   1. NIH_MGC_220

NIH_MGC_220

Name: NIH_MGC_220
Library ID: 2093
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: Pool of 3 cell lines of Myxoid Chondrosarcoma Grade II tissue. CS-7(passage 2), 105KC and JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Average insert size 3-4kb Note: this is a NIH_MGC Library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu