Name: NIH_MGC_221 Library ID: 2094 Organism: Homo sapiens Age: 0 Stage: adult Organ: mixed Tissue: Pool of 3 cell lines from Chondrosarcoma Tumor. Cell lines CS-7 (passage 2), 105KC, JJ Host: DH10B TonA Vector: pYX-Asc Vector type: plasmid Insert digest: 5' EcoRI/NotI 3' Stop Codon Status: without Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 4-5Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library