Name: NIH_MGC_235 Library ID: 2124 Organism: Rattus norvegicus Strain: Brown Norway line 3 Gender: both Age: 0 Stage: adult Organ: kidney Tissue: pooled Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: RNA obtained from pooled kidney tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_236) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.