Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NICHD_XGC_Te2N

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

testis

   1. NICHD_XGC_Te2N

NICHD_XGC_Te2N

Name: NICHD_XGC_Te2N
Library ID: 2132
Organism: Xenopus laevis
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: 6 pooled samples
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu