Name: NIH_MGC_189 Library ID: 2133 Organism: Mus musculus Strain: wild type Gender: both Age: 0 Stage: juvenile Organ: thyroid Tissue: 5 pooled Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: RNA obtained from 5 normal wild-type mice. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.2 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_230) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library