Name: NICHD_XGC_Te2 Library ID: 2135 Organism: Xenopus laevis Age: 0 Stage: adult Organ: testis Tissue: 6 pooled samples Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.25 kb. This is a primary library (normalized primary library is NICHD_XGC_Te2N) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.