Name: GISZF001_ma Library ID: 2146 Organism: Danio rerio Strain: wild type, Singapore strain Age: 0 Stage: embryo Organ: embryo Tissue: whole embryos, pooled from 7 embryonic stages Host: DH10B Vector: pDNR-LIB Vector type: plasmid Insert digest: SfiI (directional) Stop Codon Status: without Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Medium intensity clones were selected as they represented modest abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the medium abundant class ranged from 25,000 to 50,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).