Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: GISZF001_ma

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

embryo

   1. GISZF001_ma

GISZF001_ma

Name: GISZF001_ma
Library ID: 2146
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Medium intensity clones were selected as they represented modest abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the medium abundant class ranged from 25,000 to 50,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu