Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: GISZF001_ra

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library


   1. GISZF001_ra


Name: GISZF001_ra
Library ID: 2147
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Low intensity clones were selected as they represented rare expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the low abundance class ranged from 0 to 13,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to

Warning: Unknown: write failed: No space left on device (28) in Unknown on line 0

Warning: Unknown: Failed to write session data (files). Please verify that the current setting of session.save_path is correct () in Unknown on line 0