Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_255

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

brain/CNS

   1. NIH_MGC_255

NIH_MGC_255

Name: NIH_MGC_255
Library ID: 2178
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: whole brain - pooled from several tissues from one or more individuals
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library is a normalized (primary library is NIH_MGC_254) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu