Name: NIH_MGC_248 Library ID: 2181 Organism: Rattus norvegicus Strain: Brown Norway line 3 Gender: both Age: 0 Stage: juvenile Organ: spleen Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This is a primary library (normalized library is NIH_MGC_249) and was constructed by Open Biosytems. Note: this is a NIH_MGC Library.