Name: NIH_MGC_261 Library ID: 2188 Organism: Homo sapiens Gender: male Age: 0 Stage: embryo Organ: embryonic stem cell Tissue: Embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos. Markers: SSEA1-, SSEA3+, SSEA4+, Tra 1-60+, Tra 1-81+, CD9+, Alk Phos+, Oct4+, Nanog+. Passage number: 21 Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.5 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_260) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.