Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_262

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

embryonic stem cell

   1. NIH_MGC_262

NIH_MGC_262

Name: NIH_MGC_262
Library ID: 2189
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early neural progenitor cell type. Markers: Nestin+, Musashi+-. Passage number: 18
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.1 kb. This primary library is not normalized (normalized primary library is NIH_MGC_263) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu