Name: NIH_MGC_263 Library ID: 2190 Organism: Homo sapiens Gender: male Age: 0 Stage: embryo Organ: embryonic stem cell Tissue: Embryonic Stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early neural progenitor cell type. Markers: Nestin+, Musashi+-. Passage number: 18 Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_262) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.