Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_256

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

oocyte

   1. NIH_MGC_256

NIH_MGC_256

Name: NIH_MGC_256
Library ID: 2191
Organism: Mus musculus
Strain: C57BL/6J
Gender: female
Age: 0
Stage: juvenile
Organ: oocyte
Tissue: 11,000 denuded oocytes in meiotic prophase arrest oocytes were collected from 175 mice. Oocytes were collected in Gibco Liebovitz L-15 medium supplemented with 5% fetal calf serum, 100 IU/ml penicillin/streptomycin and 5uM cilostamide. Excised ovaries were punctured with 27 ga needles and cumulus enclosed oocytes were collected. The oocytes were mechanically denuded with a fine bore pipette and freed of cumulus and granulosa cells by serial dilutions. The denuded oocytes were rinsed twice in PBS, collected in 3 ul, and transferred to a microfuge tube. 30 ul of Trizol was added to each tube, which was vortexed for 5 seconds, then centrifuged briefly before snap freezing in liquid nitrogen and then stored at -70o. Mice (2325 days old) were injected IP with 5 IU of PMSG to stimulate follicle growth. Forty-four to forty eight hours later, animals were sacrificed and ovaries were excised
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.2 kb. This is a primarylibrary (normalized primary library is NIH_MGC_257) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu