Name: NIH_MGC_257 Library ID: 2192 Organism: Mus musculus Strain: C57BL/6 Gender: female Age: 0 Stage: juvenile Organ: oocyte Tissue: 11,000 denuded oocytes in meiotic prophase arrest oocytes were collected from 175 mice. Oocytes were collected in Gibco Liebovitz L-15 medium supplemented with 5% fetal calf serum, 100 IU/ml penicillin/streptomycin and 5uM cilostamide. Excised ovaries were punctured with 27 ga needles and cumulus enclosed oocytes were collected. The oocytes were mechanically denuded with a fine bore pipette and freed of cumulus and granulosa cells by serial dilutions. The denuded oocytes were rinsed twice in PBS, collected in 3 ul, and transferred to a microfuge tube. 30 ul of Trizol was added to each tube, which was vortexed for 5 seconds, then centrifuged briefly before snap freezing in liquid nitrogen and then stored at -70o. Mice (2325 days old) were injected IP with 5 IU of PMSG to stimulate follicle growth. Forty-four to forty eight hours later, animals were sacrificed and ovaries were excised Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.5 kb resulted in an average insert size of 1.0kb. This is a normalized library (primary library is NIH_MGC_256) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.