Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NIH_MGC_279

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library


   1. NIH_MGC_279


Name: NIH_MGC_279
Library ID: 2218
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: Blastocyst
Tissue: pluripotent cell line derived from blastocyst inner cell mass
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.82 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_278) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to