Name: NICHD_XGC_FaB Library ID: 2315 Organism: Xenopus laevis Strain: lab-raised (Nasco) Gender: male Age: 0 Stage: adult Organ: fat body Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.8kb. This is a primary library (normalized library is NICHD_XGC_FaBN) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.