Name: GC_BGC-28 Library ID: 2341 Organism: Bos taurus Strain: L1 Hereford Gender: female Age: 0 Stage: juvenile Organ: brain/CNS Tissue: cerebral cortex Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.9 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.