Name: NICHD_XGC_olfb Library ID: 2385 Organism: Xenopus laevis Strain: Development and evolution Gender: both Age: 0 Stage: mixed Organ: olfactory bulbs Tissue: olfactory bulbs, pooled Host: DH10B TonA Vector: pCS111 Vector type: plasmid Insert digest: 5' SmaI/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.