Name: NICHD_XGC_limb_m Library ID: 2386 Organism: Xenopus laevis Strain: Development and evolution Gender: both Age: 0 Stage: embryo Organ: limb Tissue: forelimbs and hindlimbs, pooled stages 54-61 Host: DH10B TonA Vector: pCS111 Vector type: plasmid Insert digest: 5' SmaI/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.