Name: NICHD_XGC_bone Library ID: 2418 Organism: Xenopus laevis Gender: female Age: 0 Stage: adult Organ: bone Tissue: limb bones (zeugopods and stylopods), pooled from 3 individuals Host: DH10B TonA Vector: pCS111 Vector type: plasmid Insert digest: 5' SmaI/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.65 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.