Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: NICHD_XGC_tropInt_60

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

small intestine

   1. NICHD_XGC_tropInt_60


Name: NICHD_XGC_tropInt_60
Library ID: 2437
Organism: Xenopus tropicalis
Strain: wild type
Age: 0
Stage: metamorphic
Organ: small intestine
Tissue: small intestine, 5 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
Email address:
Biological Questions and Comments to