Name: NICHD_XGC_tropInt_63 Library ID: 2439 Organism: Xenopus tropicalis Strain: wild type Age: 0 Stage: metamorphic Organ: small intestine Tissue: small intestine, 7 pooled Host: DH10B TonA Vector: pCS111 Vector type: plasmid Insert digest: 5' SmaI/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 2.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.