Name: NIH_MGC_420 Library ID: 2477 Organism: Rattus norvegicus Strain: BN/Mcwi Age: 0 Stage: embryo Organ: heart Tissue: combined sample from 36 day 12 embryos/10 pregnant females Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.