Name: NIH_MGC_431 Library ID: 2487 Organism: Rattus norvegicus Strain: BN/Mcwi Age: 0 Stage: embryo Organ: embryo Tissue: 135 pooled embryos from 33 pregnant females Host: DH10B TonA Vector: pExpress-1 Vector type: plasmid Insert digest: 5' EcoRV/NotI 3' Stop Codon Status: without Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.7kb. This is a non-normalized primary library (normalized library is NIH_MGC_432) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.