Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

cDNA library: Sugano mouse liver mlia

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 1 library

liver

   1. Sugano mouse liver mlia

Sugano mouse liver mlia

Name: Sugano mouse liver mlia
Library ID: 717
Organism: Mus musculus
Strain: C57BL
Gender: female
Age: 0
Stage: adult
Organ: liver
Host: DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA. REFERENCES: Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano, S. Construction and characterization of a full length-enriched and a 5' end enriched cDNA library. Gene 200, 149-156, 1997. Sasaki, Z., Suzuki, Y., Watanabe, M., Imai, J., Shibui, A., Yoshida, K., Hata. H., Yamaguchi, R., Tateyama, S., and Sugano, S. Construction of mouse full length-enriched cDNA libraries by oligo-capping. DNA Research, submitted.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu