Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

African clawed frog (Xenopus laevis) cDNA Library Information

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 73 libraries (by tissue)

bone

   1. NICHD_XGC_bone

brain/CNS

   2. NICHD_XGC_Brn1

egg

   3. RIKEN Xenopus egg
   4. Soares NXEG
   5. Soares SXEGG
   6. Wellcome/CRC pcDNAI egg
   7. Wellcome/CRC pSK egg
   8. X. laevis unfertilized egg

embryo

   9. Blumberg_Cho dorsal blastopore lip
   10. Cho Li-treated gastrula
   11. Harland stage 19-23
   12. Kirschner embryo St.10-14
   13. NICHD_XGC_Emb1
   14. NICHD_XGC_Emb10
   15. NICHD_XGC_Emb2
   16. NICHD_XGC_Emb3
   17. NICHD_XGC_Emb4
   18. NICHD_XGC_Emb9
   19. NICHD_XGC_int_m
   20. NICHD_XGC_tail_m
   21. OW stage 11
   22. OW stage 6
   23. Wellcome/CRC pcDNAI St.10.5
   24. Wellcome/CRC pcDNAI St.12
   25. Wellcome/CRC pcDNAI St.24-26
   26. Wellcome/CRC pCS2+ St.19-26
   27. Wellcome/CRC pRN3 dorsal lip
   28. Wellcome/CRC pRN3 head (st.30)
   29. Wellcome/CRC pRN3 St.10.5
   30. Wellcome/CRC pRN3 St.13-17
   31. Wellcome/CRC pRN3 St.13-17 egg/animal cap
   32. Wellcome/CRC pRN3 St.19-26
   33. Wellcome/CRC pRN3 St.19-26 egg/animal cap
   34. Wellcome/CRC pRN3 St.24-26
   35. Wellcome/CRC pRN3 tail (st.30)
   36. Wellcome/CRC pSK animal cap
   37. Wellcome/CRC pSK St.10.5
   38. X. laevis gastrula stages 10.5, 11.5 mixed
   39. Xenla_13
   40. Xenla_13LiCl

eye

   41. NICHD_XGC_Eye1

fat body

   42. NICHD_XGC_FaB
   43. NICHD_XGC_FaBN

Gastrula

   44. NIH_XGC_17
   45. NIH_XGC_18

heart

   46. NICHD_XGC_He1

kidney

   47. NICHD_XGC_Kid1

limb

   48. NICHD_XGC_limb
   49. NICHD_XGC_limb_m

liver

   50. NICHD_XGC_Li1

lung

   51. NICHD_XGC_Lu1

mixed

   52. NIH_XGC_21
   53. NIH_XGC_22
   54. NIH_XGC_25
   55. NIH_XGC_26

olfactory bulbs

   56. NICHD_XGC_olfb

oocyte

   57. NICHD_XGC_OO1
   58. Wellcome/CRC pRN3 oocyte
   59. X. laevis oocytes stage 5-6 mixed
   60. Xenopus laevis oocyte

ovary

   61. Harland ovary
   62. NICHD_XGC_Ov1

pancreas

   63. NICHD_XGC_panc

skin

   64. NICHD_XGC_skin_m

spleen

   65. NICHD_XGC_Sp1
   66. NICHD_XGC_sple_PHA

testis

   67. NICHD_XGC_Te1
   68. NICHD_XGC_Te2
   69. NICHD_XGC_Te2N

thymus

   70. NICHD_XGC_thy

whole body

   71. NICHD_XGC_Tad1
   72. NICHD_XGC_Tad2
   73. Xenopus laevis tadpole stage 24

NICHD_XGC_bone

Name: NICHD_XGC_bone
Library ID: 2418
Organism: Xenopus laevis
Gender: female
Age: 0
Stage: adult
Organ: bone
Tissue: limb bones (zeugopods and stylopods), pooled from 3 individuals
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.65 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Brn1

Name: NICHD_XGC_Brn1
Library ID: 1746
Organism: Xenopus laevis
Age: 0
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

RIKEN Xenopus egg

Name: RIKEN Xenopus egg
Library ID: 1732
Organism: Xenopus laevis
Age: 0
Organ: egg
Tissue: unfertilized egg
Host: DH10B
Vector: pCS2G
Vector type: plasmid
Insert digest: 5' XhoI/BamHI 3'
Stop Codon Status: without
Description: cDNA oligo-dT primed using oligo 5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3' and directionally cloned into XhoI and BamHI sites using the 5' adaptor 5'- AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3'. Size selection was done automatically by the cloning vector (lambda FLC-II, P. Carninci et al., unpublished). Library was amplified at the phage stage and normalized (RoT value = 5). This library was constructed using the CapTrapper method and Trehalose thermoactivated reverse transcriptase to enrich for full-length clones. Library constructed by Piero Carninci (RIKEN, Genome Science Laboratory, Japan: http://genome.rtc.riken.go.jp/) using egg RNA supplied by Marc Kirschner (Harvard Medical School, Dept. of Cell Biology). References: Methods Enzymol.303:19-44 and Genome Res. 10:1617-1630 Please contact Marc Kirschner (marc@hms.harvard.edu) for information on obtaining aliquots of this cDNA library.

Soares NXEG

Name: Soares NXEG
Library ID: 1531
Organism: Xenopus laevis
Age: 0
Organ: egg
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGAATCTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed in the laboratory of M. Bento Soares (University of Iowa).

Soares SXEGG

Name: Soares SXEGG
Library ID: 1606
Organism: Xenopus laevis
Age: 0
Organ: egg
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without

Wellcome/CRC pcDNAI egg

Name: Wellcome/CRC pcDNAI egg
Library ID: 1548
Organism: Xenopus laevis
Age: 0
Organ: egg
Host: GeneHogs DH10B
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

Wellcome/CRC pSK egg

Name: Wellcome/CRC pSK egg
Library ID: 1545
Organism: Xenopus laevis
Age: 0
Organ: egg
Host: GeneHogs DH10B
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

X. laevis unfertilized egg

Name: X. laevis unfertilized egg
Library ID: 1592
Organism: Xenopus laevis
Age: 0
Organ: egg
Tissue: fertilized egg
Host: TOP10
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. 500,000 unamplified cDNAs were mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine), also referred to as Xenopus_laevis_unfertilized_egg_cDNA_library.

Blumberg_Cho dorsal blastopore lip

Name: Blumberg_Cho dorsal blastopore lip
Library ID: 2160
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: dorsal blastopore lip
Host: TOP10
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Library was prepared from 50 ug of total RNA by oligo-dT priming and AMV reverse transcriptase. After addition of EcoRI linkers and EcoRI-XhoI digestion, the cDNA was size selected by chromatography on Sepharose CL-4B columns and fractions containing cDNAs larger than 500 bp were ligated into EcoRI-XhoI-digested lambda ZAPII (UniZAP-XR) and packaged in vitro. Average insert size is 1.4 kb. The original library contained 6 x 106 recombinants, of which 3 x 106 were amplified and stored at 70C in SM buffer containing 7% DMSO. 3 x 106 pfu were mass excised and the resulting phagemids used to infect Top10F'. References: Science 253, 196-196 and Methods in Molecular Biology 97, 555-574. Additional sequences from this library have been deposited under the name Xenopus laevis dorsal blastopore lip. Library constructed by Bruce Blumberg (University of California, Irvine, Department of Developmental and Cell Biology).

Cho Li-treated gastrula

Name: Cho Li-treated gastrula
Library ID: 1612
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: Li-treated gastrula
Host: DH10B
Vector: pBluescript KS+
Vector type: phagemid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and Eco RI sites of pBluescript KS+. Library was constructed by C. Hashimoto, Ph.D., in the laboratory of K. Cho, Ph.D. (Department of Developmental and Cell Biology, University of California, Irvine).

Harland stage 19-23

Name: Harland stage 19-23
Library ID: 1516
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: neurula
Host: GeneHogs DH10B
Vector: pCS107
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Library constructed in the laboratory of R. Harland, Ph.D. (University of California, Berkeley).

Kirschner embryo St.10-14

Name: Kirschner embryo St.10-14
Library ID: 1544
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pCS2+
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Size-selected for average insert size 1.2 kb. Library was constructed and donated by M. Kirschner (Harvard Medical School).

NICHD_XGC_Emb1

Name: NICHD_XGC_Emb1
Library ID: 1543
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.55 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Emb10

Name: NICHD_XGC_Emb10
Library ID: 2308
Organism: Xenopus laevis
Strain: wild type
Age: 0
Stage: embryo
Organ: embryo
Tissue: Embryonic stage 17/19
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 1.8kb. This is a normalized library (primary library is NICHD_XGC_Emb9) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Emb2

Name: NICHD_XGC_Emb2
Library ID: 1723
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Life Technologies. NOTE: based on EST sequencing of several thousand clones from this library, there appears to be a low level of mouse background in this library; please use care when evaluating sequences from this library. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Emb3

Name: NICHD_XGC_Emb3
Library ID: 1542
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Emb4

Name: NICHD_XGC_Emb4
Library ID: 1677
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Emb9

Name: NICHD_XGC_Emb9
Library ID: 2307
Organism: Xenopus laevis
Strain: wild type
Age: 0
Stage: embryo
Organ: embryo
Tissue: Embryonic stage 17/19
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.1kb. This is a non-normalized primary library (normalized library is NICHD_XGC_Emb10) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_int_m

Name: NICHD_XGC_int_m
Library ID: 2383
Organism: Xenopus laevis
Strain: Development and evolution
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo - stages 56-62
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_tail_m

Name: NICHD_XGC_tail_m
Library ID: 2384
Organism: Xenopus laevis
Strain: Development and evolution
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: tails, stage 56-62
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

OW stage 11

Name: OW stage 11
Library ID: 1825
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula
Host: DH10B
Vector: pCS2+
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming using 5'-GAGAGAGAGAGAGAGAGAGAACTAGGCTCGAGTTTTTTTTTTTTTTTTTT-3'. Directionally cloned into EcoRI/XhoI sites using the following 5' adaptor: 5'-CTCGTGCCGAATT-3'. Size selected for average insert size 2 kb. Library constructed in the De Robertis laboratory (HHMI/UCLA; 5577 MRL; 675 Circle Drive South; Los Angeles, CA 90024).

OW stage 6

Name: OW stage 6
Library ID: 1826
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: pre-blastula
Host: DH10B
Vector: pCS2+
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming using 5'-GAGAGAGAGAGAGAGAGAGAACTAGGCTCGAGTTTTTTTTTTTTTTTTTT-3'. Directionally cloned into EcoRI/XhoI sites using the following 5' adaptor: 5'-CTCGTGCCGAATT-3'. Size selected for average insert size 2 kb. Library constructed in the De Robertis laboratory (HHMI/UCLA; 5577 MRL; 675 Circle Drive South; Los Angeles, CA 90024).

Wellcome/CRC pcDNAI St.10.5

Name: Wellcome/CRC pcDNAI St.10.5
Library ID: 1549
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

Wellcome/CRC pcDNAI St.12

Name: Wellcome/CRC pcDNAI St.12
Library ID: 1550
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute). There have been no sequences generated or submitted to Genbank from this library.

Wellcome/CRC pcDNAI St.24-26

Name: Wellcome/CRC pcDNAI St.24-26
Library ID: 1551
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

Wellcome/CRC pCS2+ St.19-26

Name: Wellcome/CRC pCS2+ St.19-26
Library ID: 1560
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pCS2+
Vector type: plasmid
Insert digest: 5' EcoRI/SalI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 dorsal lip

Name: Wellcome/CRC pRN3 dorsal lip
Library ID: 1553
Organism: Xenopus laevis
Age: 0
Organ: embryo
Tissue: dorsal lip
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by A.M. Zorn (Wellcome/CRC Institute).

Wellcome/CRC pRN3 head (st.30)

Name: Wellcome/CRC pRN3 head (st.30)
Library ID: 1558
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: head
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, K. Ryan and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.10.5

Name: Wellcome/CRC pRN3 St.10.5
Library ID: 1554
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.13-17

Name: Wellcome/CRC pRN3 St.13-17
Library ID: 1555
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, E. Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.13-17 egg/animal cap

Name: Wellcome/CRC pRN3 St.13-17 egg/animal cap
Library ID: 1561
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: egg/animal cap
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library is subtracted and was constructed by N. Garrett, E Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.19-26

Name: Wellcome/CRC pRN3 St.19-26
Library ID: 1556
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, E. Bellefroid, and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.19-26 egg/animal cap

Name: Wellcome/CRC pRN3 St.19-26 egg/animal cap
Library ID: 1562
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: egg/animal cap
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library is subtracted and was constructed by N. Garrett and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 St.24-26

Name: Wellcome/CRC pRN3 St.24-26
Library ID: 1557
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pRN3 tail (st.30)

Name: Wellcome/CRC pRN3 tail (st.30)
Library ID: 1559
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: tail
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, K. Ryan and A.M. Zorn, (Wellcome/CRC Institute).

Wellcome/CRC pSK animal cap

Name: Wellcome/CRC pSK animal cap
Library ID: 1547
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: animal cap
Host: GeneHogs DH10B
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

Wellcome/CRC pSK St.10.5

Name: Wellcome/CRC pSK St.10.5
Library ID: 1546
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Host: GeneHogs DH10B
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

X. laevis gastrula stages 10.5, 11.5 mixed

Name: X. laevis gastrula stages 10.5, 11.5 mixed
Library ID: 1593
Organism: Xenopus laevis
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula
Host: TOP10
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine); also referred to as Xenopus_laevis_gastrula_non_normalized.

Xenla_13

Name: Xenla_13
Library ID: 1410
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: XL-1 Blue
Vector: pBluescript KS+
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into SalI/NotI sites using the following 5' adaptor: tcgacccacgcgtccg and 3' adaptor: gactagttctagatcgcgagcggccgcccttttttttttttttt. Average insert size 1.3kb. Primary library, non-amplified. Library constructed by V. Gawantka, PhD. REF: Gawantka, V., Pollet, N., Delius, H., Vingron, M., Pfister, R., Nitsch, R., Blumenstock, C., and Niehrs, C. (1998) Gene expression screening in Xenopus identifies molecular pathways, predicts gene function and provides a global view of embryonic patterning. Mech. Dev. 77:95-141.

Xenla_13LiCl

Name: Xenla_13LiCl
Library ID: 1411
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: XL-1 Blue
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/NotI sites using the following 5' adaptor: gaattccccggg and 3' adaptor: agagaactagtgtcgacgcggccgcttttttttttttttttttt. Vector designed for mRNA injections (reference Lemaire et al. (1995) 81:85-94). Average insert size 1.6kb. Primary library, non-amplified. Library constructed by A. Glinka, PhD. REF: Glinka, et al. (1996) Combinatorial signaling by Xwnt-11 and Xnr3 in the organizer epithelium. Mech. Dev. 60:221-231.

NICHD_XGC_Eye1

Name: NICHD_XGC_Eye1
Library ID: 1745
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: eye
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_FaB

Name: NICHD_XGC_FaB
Library ID: 2315
Organism: Xenopus laevis
Strain: lab-raised (Nasco)
Gender: male
Age: 0
Stage: adult
Organ: fat body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.8kb. This is a primary library (normalized library is NICHD_XGC_FaBN) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_FaBN

Name: NICHD_XGC_FaBN
Library ID: 2316
Organism: Xenopus laevis
Strain: lab-raised (Nasco)
Gender: male
Age: 0
Stage: adult
Organ: fat body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.5kb, and Cot value of 7. This is a normalized library (primary library is NICHD_XGC_FaB) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NIH_XGC_17

Name: NIH_XGC_17
Library ID: 2522
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: Gastrula
Tissue: Xenopus laevis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NIH_XGC_18

Name: NIH_XGC_18
Library ID: 2523
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: Gastrula
Tissue: Xenopus laevis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NICHD_XGC_He1

Name: NICHD_XGC_He1
Library ID: 1724
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: heart
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Kid1

Name: NICHD_XGC_Kid1
Library ID: 1629
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: kidney
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_limb

Name: NICHD_XGC_limb
Library ID: 2408
Organism: Xenopus laevis
Strain: wild type
Gender: both
Age: 0
Stage: juvenile
Organ: limb
Tissue: hind limb
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.1 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads, and m13rp for 5' end reads. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_limb_m

Name: NICHD_XGC_limb_m
Library ID: 2386
Organism: Xenopus laevis
Strain: Development and evolution
Gender: both
Age: 0
Stage: embryo
Organ: limb
Tissue: forelimbs and hindlimbs, pooled stages 54-61
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Li1

Name: NICHD_XGC_Li1
Library ID: 1540
Organism: Xenopus laevis
Age: 0
Organ: liver
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.4 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Lu1

Name: NICHD_XGC_Lu1
Library ID: 1628
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: lung
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.6 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NIH_XGC_21

Name: NIH_XGC_21
Library ID: 2524
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: mixed
Tissue: Xenopus laevis gastrula, tailbud
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NIH_XGC_22

Name: NIH_XGC_22
Library ID: 2525
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: embryo
Organ: mixed
Tissue: Xenopus laevis gastrula, tailbud
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NIH_XGC_25

Name: NIH_XGC_25
Library ID: 2526
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus laevis oocytes, tailbud, gastrula, ovary, head, testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NIH_XGC_26

Name: NIH_XGC_26
Library ID: 2527
Organism: Xenopus laevis
Gender: both
Age: 0
Stage: mixed
Organ: mixed
Tissue: Xenopus laevis oocytes, tailbud, gastrula, ovary, head, testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.

NICHD_XGC_olfb

Name: NICHD_XGC_olfb
Library ID: 2385
Organism: Xenopus laevis
Strain: Development and evolution
Gender: both
Age: 0
Stage: mixed
Organ: olfactory bulbs
Tissue: olfactory bulbs, pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25 kb resulted in an average insert size of 1.25 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_OO1

Name: NICHD_XGC_OO1
Library ID: 1541
Organism: Xenopus laevis
Age: 0
Organ: oocyte
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.2 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

Wellcome/CRC pRN3 oocyte

Name: Wellcome/CRC pRN3 oocyte
Library ID: 1552
Organism: Xenopus laevis
Age: 0
Organ: oocyte
Host: GeneHogs DH10B
Vector: pBSRN3
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: cDNAs were oligo-dT primed and directionally cloned. Staging according to Nieuwkoop and Faber. Library was constructed by N. Garrett, P. LeMaire, A.M. Zorn, and J.B. Gurdon (Wellcome/CRC Institute).

X. laevis oocytes stage 5-6 mixed

Name: X. laevis oocytes stage 5-6 mixed
Library ID: 1594
Organism: Xenopus laevis
Age: 0
Organ: oocyte
Host: TOP10
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were used to infect TOP10F'. This library has been used successfully to clone a number of full-length cDNAs ranging in size from 1.4-4.5 kb. There are <0.5% clones with multiple inserts. One should be suspicious of any clone which gives 3 or more bands in an EcoRI/XhoI digest AND has an internal XhoI site. Library constructed and donated by B. Blumberg (University of California, Irvine); also referred to as Xenopus_laevis_ooctye_non_normalized.

Xenopus laevis oocyte

Name: Xenopus laevis oocyte
Library ID: 1931
Organism: Xenopus laevis
Age: 0
Organ: oocyte
Host: TOP10
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA from 2 ug polyA+ mRNA, oligo dT-primed using 5'-ACTAGTGCGGCCGCCTAGGCCTCGAGTTTTTTTTTTTTTTT-3'. Library was mass excised (from lambda-ZAPII) using ExAssist phage. The resulting single-stranded phagemids were normalized by hybridization to biotinylated driver (prepared from the same library by PCR) to Cot11. After removal of hybrids and excess driver by streptavidin sepharose chromatography, the ss-phagemids were made double-stranded. Original library (X.laevis occytes, stages 5-6 mixed) constructed and donated by B. Blumberg (University of California, Irvine), normalization by J. Song.

Harland ovary

Name: Harland ovary
Library ID: 1515
Organism: Xenopus laevis
Gender: female
Age: 0
Organ: ovary
Host: GeneHogs DH10B
Vector: pCS105
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Library constructed in the laboratory of R. Harland, Ph.D. (University of California, Berkeley).

NICHD_XGC_Ov1

Name: NICHD_XGC_Ov1
Library ID: 1627
Organism: Xenopus laevis
Gender: female
Age: 0
Organ: ovary
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.0 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_panc

Name: NICHD_XGC_panc
Library ID: 2417
Organism: Xenopus laevis
Gender: female
Age: 0
Stage: adult
Organ: pancreas
Tissue: whole pancreas, 3 pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_skin_m

Name: NICHD_XGC_skin_m
Library ID: 2409
Organism: Xenopus laevis
Strain: wild type
Gender: both
Age: 0
Stage: embryo
Organ: skin
Tissue: dorsal back skin, pooled
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >900 bp resulted in an average insert size of 1.2 kb. This primary library was constructed by Express Genomics (Frederick, MD). Use M13(-21) primer for 3' end reads and m13rp for 5' reads. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Sp1

Name: NICHD_XGC_Sp1
Library ID: 1678
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: spleen
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.4 kb. Constructed by Life Technologies. Note: this is a Xenopus Gene Collection library.

NICHD_XGC_sple_PHA

Name: NICHD_XGC_sple_PHA
Library ID: 2380
Organism: Xenopus laevis
Strain: pool of 6 outbred strains
Gender: both
Age: 0
Stage: adult
Organ: spleen
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25-3' and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.2kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Te1

Name: NICHD_XGC_Te1
Library ID: 2006
Organism: Xenopus laevis
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.2kb (range 0.4-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Te2

Name: NICHD_XGC_Te2
Library ID: 2135
Organism: Xenopus laevis
Age: 0
Stage: adult
Organ: testis
Tissue: 6 pooled samples
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.25 kb. This is a primary library (normalized primary library is NICHD_XGC_Te2N) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Te2N

Name: NICHD_XGC_Te2N
Library ID: 2132
Organism: Xenopus laevis
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: 6 pooled samples
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.15 kb. This primary, microquantity library is normalized to Cot5 (non-normalized primary library is NICHD_XGC_Te2) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_thy

Name: NICHD_XGC_thy
Library ID: 2387
Organism: Xenopus laevis
Strain: pool of 40 outbred strains
Age: 0
Stage: adult
Organ: thymus
Tissue: thymus/thymocytes
Host: DH10B TonA
Vector: pCS111
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: GACTAGTTCTAGATCGCGAGCGGCCGCC(T)25 and cloned into the SmaI/NotI sites of pCS111. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This primary library was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Tad1

Name: NICHD_XGC_Tad1
Library ID: 2000
Organism: Xenopus laevis
Age: 0
Organ: whole body
Tissue: developing tadpole
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.6 kb (range 0.9-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

NICHD_XGC_Tad2

Name: NICHD_XGC_Tad2
Library ID: 2001
Organism: Xenopus laevis
Age: 0
Stage: juvenile
Organ: whole body
Tissue: Xenopus - developing tadpole
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.7 kb (range 0.8-3.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a Xenopus Gene Collection library.

Xenopus laevis tadpole stage 24

Name: Xenopus laevis tadpole stage 24
Library ID: 1932
Organism: Xenopus laevis
Gender: both
Age: 0
Organ: whole body
Tissue: whole tadpole, pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed by Dr. B. Korn and Sabine Henze (RZPD).

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu