Biosciences Directorate logo

I.M.A.G.E. Consortium

“Sharing resources to achieve a common goal — the discovery of all genes”

blue/green horizontal line

rat (Rattus norvegicus) cDNA Library Information

Home | Site Map | I.Q. search | Libraries by Species | Clones | Vectors | Primers | QC | Arrayed Clones by: Library | Tissue |

Information for 91 libraries (by tissue)

brain/CNS

   1. NIH_MGC_254
   2. NIH_MGC_255
   3. NIH_MGC_365
   4. NIH_MGC_366
   5. UI-R-BO0
   6. UI-R-BO1
   7. UI-R-BT1
   8. UI-R-G0

cartilage

   9. NCI_CGAP_DY0
   10. NCI_CGAP_DY1
   11. NCI_CGAP_DZ0
   12. NCI_CGAP_DZ1
   13. NCI_CGAP_FF0
   14. NCI_CGAP_FS0
   15. NCI_CGAP_FS1 (alt)

embryo

   16. NCI_CGAP_Emb2
   17. NIH_MGC_431
   18. NIH_MGC_432
   19. UI-R-BS0
   20. UI-R-E0
   21. UI-R-E1

eye

   22. UI-R-BU0
   23. UI-R-Y0

heart

   24. NIH_MGC_233
   25. NIH_MGC_234
   26. NIH_MGC_420
   27. NIH_MGC_421
   28. UI-R-AA0
   29. UI-R-AA1
   30. UI-R-AB0
   31. UI-R-AB1
   32. UI-R-AC0
   33. UI-R-AC1
   34. UI-R-AD0
   35. UI-R-AD1
   36. UI-R-AE0
   37. UI-R-AE1
   38. UI-R-AF0
   39. UI-R-AF1
   40. UI-R-AG0
   41. UI-R-AG1
   42. UI-R-BJ0
   43. UI-R-BJ0p
   44. UI-R-C4

kidney

   45. NIH_MGC_235
   46. NIH_MGC_236
   47. NIH_MGC_418
   48. NIH_MGC_419

liver

   49. NIH_MGC_246
   50. NIH_MGC_247
   51. NIH_MGC_367
   52. NIH_MGC_368

lung

   53. NIH_MGC_231
   54. NIH_MGC_232
   55. NIH_MGC_429
   56. NIH_MGC_430

mixed

   57. UI-R-A0
   58. UI-R-A1
   59. UI-R-BT0
   60. UI-R-C0
   61. UI-R-C1
   62. UI-R-C2
   63. UI-R-C2p
   64. UI-R-C3

ovary

   65. NIH_MGC_252
   66. NIH_MGC_253

pituitary gland

   67. NICHD_Rr_Pit1

placenta

   68. NIH_MGC_269
   69. NIH_MGC_270

prostate

   70. NCI_CGAP_Pr29
   71. NCI_CGAP_Pr30
   72. NCI_CGAP_Pr32
   73. NCI_CGAP_Pr33
   74. NCI_CGAP_Pr35
   75. NCI_CGAP_Pr39
   76. NCI_CGAP_Pr40
   77. NCI_CGAP_Pr41
   78. NCI_CGAP_Pr42
   79. NCI_CGAP_Pr46
   80. NCI_CGAP_Pr47
   81. NCI_CGAP_Pr49
   82. NCI_CGAP_Pr50
   83. NCI_CGAP_Pr51

spleen

   84. NIH_MGC_248
   85. NIH_MGC_249
   86. NIH_MGC_433
   87. NIH_MGC_434

testis

   88. NIH_MGC_237
   89. NIH_MGC_238

thymus

   90. NIH_MGC_250
   91. NIH_MGC_251

NIH_MGC_254

Name: NIH_MGC_254
Library ID: 2177
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: whole brain - pooled from several tissues from one or more individuals
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 2.18 kb. This primary library is not normalized (normalized library is NIH_MGC_255) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

NIH_MGC_255

Name: NIH_MGC_255
Library ID: 2178
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: whole brain - pooled from several tissues from one or more individuals
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This primary library is a normalized (primary library is NIH_MGC_254) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

NIH_MGC_365

Name: NIH_MGC_365
Library ID: 2376
Organism: Rattus norvegicus
Strain: BN/NHsdMcwi
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: whole brain, pool of 7
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 2.0kb. This is a non-normalized primary library (normalized primary library is NIH_MGC_366) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_366

Name: NIH_MGC_366
Library ID: 2377
Organism: Rattus norvegicus
Strain: BN/NHsdMcwi
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: whole brain, pool of 7
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.8kb. This is a normalized primary library to Cot5 (non-normalized primary library is NIH_MGC_365) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

UI-R-BO0

Name: UI-R-BO0
Library ID: 1573
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: UI-R-BO0 is a subtracted library derived from a mixture of 9 individuallytagged and normalized libraries comprising 9 brain regions: thalamus (12%), cerebellum (10.5%), hypothalamus (9%), medulla (12%), pons (9%), midbrain (12%), cerebral cortex (10.5%), corpus striatum (13%), and hippocampus (12%). The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BO1

Name: UI-R-BO1
Library ID: 1576
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: brain/CNS
Tissue: hypothalamus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BO1 library is a subtracted library derived from the UI-R-BO0library, consisting of a mixture of the following tissues: thalamus, cerebellum, hypothalamus, medulla, pons, midbrain, cerebral cortex, corpus striatum, and hippocampus. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BT1

Name: UI-R-BT1
Library ID: 1580
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: brain/CNS
Tissue: midbrain
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BT1 library is a subtracted library derived from a mixtureof the following tissues: hippocampus, thalamus, midbrain, medulla, corpus striatum, cerebral cortex, and testis. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-G0

Name: UI-R-G0
Library ID: 1494
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: brain/CNS
Tissue: pooled nodose ganglia, dorsal root ganglia, and trigeminal ganglia
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This is a normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

NCI_CGAP_DY0

Name: NCI_CGAP_DY0
Library ID: 2195
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: femoral head and condyle of the tibia plateau
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTAATGGACGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DY1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_DY1

Name: NCI_CGAP_DY1
Library ID: 2196
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: femoral head and condyle of the tibia plateau
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTAATGGACGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_DY0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_DZ0

Name: NCI_CGAP_DZ0
Library ID: 2197
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: Swarm rat chondrosarcoma, subcutaneous transplantation
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCATTCTTGTATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_DZ1

Name: NCI_CGAP_DZ1
Library ID: 2198
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: Swarm rat chondrosarcoma, subcutaneous transplantation
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCATTCTTGTATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_DZ0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_FF0

Name: NCI_CGAP_FF0
Library ID: 2199
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: pool of normal cartilage from femoral head and condyle of the tibia plateau, and Swarm rat chondrosarcoma
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This is a subtracted library from a normalized rat cartilage library (NCI_CGAP_DY1) and a normalized Swarm rat chondrosarcoma library (NCI_CGAP_DZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_FS0

Name: NCI_CGAP_FS0
Library ID: 2200
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: Swarm rat chondrosarcoma, tibia transplantation
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGCCGATTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FS1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_FS1 (alt)

Name: NCI_CGAP_FS1 (alt)
Library ID: 2201
Organism: Rattus norvegicus
Age: 0
Organ: cartilage
Tissue: Swarm rat chondrosarcoma, tibia transplantation
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGCCGCCGATTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A non-normalized version of this library is also available (NCI_CGAP_FS0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.

NCI_CGAP_Emb2

Name: NCI_CGAP_Emb2
Library ID: 1676
Organism: Rattus norvegicus
Age: 0
Stage: embryo
Organ: embryo
Tissue: embryo, pluripotent cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.54 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


NIH_MGC_431

Name: NIH_MGC_431
Library ID: 2487
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: embryo
Tissue: 135 pooled embryos from 33 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.7kb. This is a non-normalized primary library (normalized library is NIH_MGC_432) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_432

Name: NIH_MGC_432
Library ID: 2488
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: embryo
Tissue: 135 pooled embryos from 33 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.55kb. This library is normalized to Cot7 (primary library is NIH_MGC_431) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

UI-R-BS0

Name: UI-R-BS0
Library ID: 1574
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryo
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BS0 library is a non-normalized library derived from 13 dpcwhole embryo tissue. Insert sizes range from 0.5-2.0 kb. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-E0

Name: UI-R-E0
Library ID: 1212
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: embryo
Tissue: pool (ages 8, 12 and 18 days postconception)
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library consists of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone within the mixture. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-E1

Name: UI-R-E1
Library ID: 1213
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: embryo
Tissue: pool (ages 8, 12 and 18 days postconception)
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the normalized pooled UI-R-E1 library (consisting of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone within the mixture. The UI-R-E1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-E0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-E0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BU0

Name: UI-R-BU0
Library ID: 1575
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: eye
Tissue: The UI-R-BU0 library is a subtracted library derived from a mixture (50% of each) of two libraries: UI-R-G0, a normalized library from rat ganglia (derived from a mixture of trigerminal ganglia, nodose ganglia, and dorsal rod ganglia), and UI-R-Y0, a subtracted library derived from a normalized rat eye library (whole adult eye without lenses).
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BU0 library is a subtracted library derived from a mixture(50% of each) of two libraries: UI-R-G0, a normalized library from rat ganglia (derived from a mixture of trigerminal ganglia, nodose ganglia, and dorsal rod ganglia), and UI-R-Y0, a subtracted library derived from a normalized rat eye library (whole adult eye without lenses). The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-Y0

Name: UI-R-Y0
Library ID: 1493
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: eye
Tissue: whole eye minus the lens
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived frmo an individually-tagged normalized whole-eye (minus the lens) library. The driver for the subtraction consisted of a pool of previous libraries: UI-R-A0, UI-R-A1, UI-R-E0, UI-R-E1, UI-R-C0, and UI-R-C1. The UI-R-Y0 subtracted library was constructed as follows: PCR amplified cDNA inserts from previous library clones from which 3' ESTs had been derived was used as a driver in a hybridization with the normalized whole eye library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

NIH_MGC_233

Name: NIH_MGC_233
Library ID: 2122
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: heart
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled heart tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2 kb. This primary library is not normalized (normalized primary library is NIH_MGC_234) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_234

Name: NIH_MGC_234
Library ID: 2123
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: heart
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled heart tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_233) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_420

Name: NIH_MGC_420
Library ID: 2477
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: heart
Tissue: combined sample from 36 day 12 embryos/10 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_421

Name: NIH_MGC_421
Library ID: 2478
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: heart
Tissue: combined sample from 36 day 12 embryos/10 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 1.7kb. Library was normalized to cot 4.5 (non-normalized primary library is NIH_MGC_420) and was constructed by Express Genomics (Frederick, MD) for the Xenopus Gene Collection.

UI-R-AA0

Name: UI-R-AA0
Library ID: 1506
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrium
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag GATTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AA1

Name: UI-R-AA1
Library ID: 1477
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrium
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag GATTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AB0

Name: UI-R-AB0
Library ID: 1478
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This is a non-normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AB1

Name: UI-R-AB1
Library ID: 1479
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This is a normalized library. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AC0

Name: UI-R-AC0
Library ID: 1480
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrioventricular canal
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag GAACC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AC1

Name: UI-R-AC1
Library ID: 1481
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrioventricular canal
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag GAACC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AD0

Name: UI-R-AD0
Library ID: 1482
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrium
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag GAAGC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AD1

Name: UI-R-AD1
Library ID: 1483
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrium
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag GAAGC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AE0

Name: UI-R-AE0
Library ID: 1484
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag GTGTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AE1

Name: UI-R-AE1
Library ID: 1486
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag GTGTC. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AF0

Name: UI-R-AF0
Library ID: 1487
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrioventricular canal
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag GAAGG. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AF1

Name: UI-R-AF1
Library ID: 1488
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrioventricular canal
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag GAAGG. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AG0

Name: UI-R-AG0
Library ID: 1485
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This non-normalized library has the tag CAGCGA. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-AG1

Name: UI-R-AG1
Library ID: 1489
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This normalized library has the tag CAGCGA. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo dT track which allows identification of the library of origin of a clone. The library was constructed as described in Genome Research 6:791-806. Tissue provided by Jim Lin, Department of Biology, University of Iowa. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BJ0

Name: UI-R-BJ0
Library ID: 1578
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: atrioventricular canal
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BJ0 library is a subtracted library derived from theUI-R-AA1, UI-R-AB1, UI-R-AC1, UI-R-AD1, UI-R-AE1, UI-R-AF1, and UI-R-AG1 libraries. These libraries represent tissues from rat atrium at 16.5 dpc, ventricle at 16.5 dpc, AV canal at 16.5 dpc, atrium at 15 dpc, ventricle at 15 dpc, AV canal at 15 dpc, and ventricle at 13 dpc. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BJ0p

Name: UI-R-BJ0p
Library ID: 1577
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Stage: embryo
Organ: heart
Tissue: ventricle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-BJ0p library is a subtracted library derived from theUI-R-AA1, UI-R-AB1, UI-R-AC1, UI-R-AD1, UI-R-AE1, UI-R-AF1, and UI-R-AG1 libraries. These libraries represent tissues from rat atrium at 16.5 dpc, ventricle at 16.5 dpc, AV canal at 16.5 dpc, atrium at 15 dpc, ventricle at 15 dpc, AV canal at 15 dpc, and ventricle at 13 dpc. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C4

Name: UI-R-C4
Library ID: 1579
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: heart
Tissue: atrium (16.5 dpc), ventricle (16.5 dpc), AV canal (16.5 dpc), atrium (15 dpc), ventricle (15 dpc), AV canal (15 dpc), and ventricle (13 dpc).
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: The UI-R-C4 library is a subtracted library of a series, ultimatelyderived from a mixture of tissues from rat placenta, adult lung, brain, liver, kidney, heart, spleen, ovary, muscle, and 8-, 12-, and 18-day embryos. The library was constructed as described in Genome Research 6:791-806 in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

NIH_MGC_235

Name: NIH_MGC_235
Library ID: 2124
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: kidney
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled kidney tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_236) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_236

Name: NIH_MGC_236
Library ID: 2125
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: kidney
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled kidney tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.2 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_235) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_418

Name: NIH_MGC_418
Library ID: 2475
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: kidney
Tissue: combined sample from 60 day 13 embryos/17 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.0kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_419

Name: NIH_MGC_419
Library ID: 2476
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: kidney
Tissue: combined sample from 60 day 13 embryos/17 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 1.85kb. This library has been normalized to cot 4.5 (non-normalized primary library is NIH_MGC_418) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_246

Name: NIH_MGC_246
Library ID: 2179
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: liver
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This a primary library (normalized library is NIH_MGC_247) and was constructed by Open Biosystems. Note: this is a NIH_MGC library

NIH_MGC_247

Name: NIH_MGC_247
Library ID: 2180
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: liver
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.6 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_246) and was constructed by Open Biosystems. Note: this is a NIH_MGC Library.

NIH_MGC_367

Name: NIH_MGC_367
Library ID: 2378
Organism: Rattus norvegicus
Strain: BN/NHsdMcwi
Age: 0
Stage: embryo
Organ: liver
Tissue: whole liver, pool of 7
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.8kb. This is a non-normalized primary library (normalized primary library is NIH_MGC_368) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_368

Name: NIH_MGC_368
Library ID: 2379
Organism: Rattus norvegicus
Strain: BN/NHsdMcwi
Age: 0
Stage: embryo
Organ: liver
Tissue: whole liver, pool of 7
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.3kb resulted in an average insert size of 1.4kb. This is a normalized primary library to Cot5 (non-normalized primary library is NIH_MGC_367) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_231

Name: NIH_MGC_231
Library ID: 2120
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: lung
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled lung tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.3 kb. This primary library is not normalized (normalized primary library is NIH_MGC_232) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_232

Name: NIH_MGC_232
Library ID: 2121
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: adult
Organ: lung
Tissue: pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pooled lung tissue from a mix of male and female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.3 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_231) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_429

Name: NIH_MGC_429
Library ID: 2485
Organism: Rattus norvegicus
Strain: BN/Mcwi
Gender: both
Age: 0
Stage: embryo
Organ: lung
Tissue: normal lung from day 12 embryos (82 pooled, from 18 females)
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.5kb. This is a non-normalized primary library (normalized library is NIH_MGC_430) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_430

Name: NIH_MGC_430
Library ID: 2486
Organism: Rattus norvegicus
Strain: BN/Mcwi
Gender: both
Age: 0
Stage: embryo
Organ: lung
Tissue: normal lung from day 12 embryos (82 pooled, from 18 females)
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.1kb. This library was normalized to cot 5 (non-normalized primary library is NIH_MGC_429) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

UI-R-A0

Name: UI-R-A0
Library ID: 1209
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: pool: ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library consists of a mixture of individually taggednormalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-A1

Name: UI-R-A1
Library ID: 1210
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: pool: ovary, lung (adult), placenta, brain, liver, kidney, spleen, heart, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the UI-R-A0 normalized pooled library, consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-A1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of approximately 3840 UI-R-A0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-A0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-BT0

Name: UI-R-BT0
Library ID: 1490
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: brain (hippocampus, thalamus, mid-brain, medulla, corpus striatum, cerebral cortex) and testis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library consists of a mixture of individually taggednormalized libraries constructed from rat hippocampus, thalamus, mid- brain, medulla, corpus striatum, cerebral cortex, and testis. This library was subtracted using a driver consisting of a mixture of all clones from UI-R-A0, UI-R-A1, UI-R-E0, UI-R-E1, UI-R-C0, UI-R-C1, UI-R-C2, and UI-R-C2p. The library was constructed as described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C0

Name: UI-R-C0
Library ID: 1211
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: embryo (8, 12 and 18 days postconception), ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the UI-R-A1 normalized pooled library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), and muscle (AAG). The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture) and the normalized pooled UI-R-E1 library (consisting of a mixture of individually tagged normalized libraries constructed from 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos). The UI-R-C0 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-A1 and UI-R-E1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-A1 and UI-R-E1 libraries in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C1

Name: UI-R-C1
Library ID: 1491
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: embryo (8, 12 and 18 days postconception), ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the UI-R-C0 subtracted library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C1 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C0 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C0 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C2

Name: UI-R-C2
Library ID: 1492
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: embryo (8, 12 and 18 days postconception), ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the UI-R-C1 subtracted library, derived from the UI-R-C0 library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C2 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C1 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C2p

Name: UI-R-C2p
Library ID: 1495
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: embryo (8, 12 and 18 days postconception), ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library derived from the UI-R-C1 subtracted library, derived from the UI-R-C0 library (consisting of a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos. The tag is a string of 3-5 nucleotides present between the NotI site and the oligo-dT track which allow identification of the library of origin of a clone within the mixture. The UI-R-C2p subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C1 clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C1 library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

UI-R-C3

Name: UI-R-C3
Library ID: 1496
Organism: Rattus norvegicus
Strain: Sprague-Dawley
Age: 0
Organ: mixed
Tissue: embryo (8, 12 and 18 days postconception), ovary, lung, placenta, brain, liver, kidney, heart, spleen, muscle
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This library is a subtracted library of a series, ultimatelyderived from a mixture of individually tagged normalized libraries constructed from rat placenta (tag ATGTG), adult lung (TTCCA), brain (TAGAG), liver (CACAC), kidney (CAAAC), heart (ACAAC), spleen (GAGA), ovary (TCAC), muscle (AAG), 8-day (tag AATG), 12-day (AATTG), and 18-day (AAAGG) embryos, after a series of subtractions to reduce the representation of cDNAs from which ESTs had already been generated. The UI-R-C3 subtracted library was constructed as follows: PCR amplified cDNA inserts from a pool of UI-R-C2p clones from which 3' ESTs had been derived was used as a driver in a hybridization with the UI-R-C2p library in the form of single-stranded circles. This procedure has been previously described in Genome Research 6:791-806. This library was constructed in the laboratory of M. Bento Soares, PhD. as part of the University of Iowa Rat EST Project.

NIH_MGC_252

Name: NIH_MGC_252
Library ID: 2175
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: female
Age: 0
Stage: adult
Organ: ovary
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from female overies animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7kb. This primary library is not normalized (normalized library is NIH_MGC_252) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library

NIH_MGC_253

Name: NIH_MGC_253
Library ID: 2176
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: female
Age: 0
Stage: adult
Organ: ovary
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from female animals at 8 wk old. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.5 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_252) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NICHD_Rr_Pit1

Name: NICHD_Rr_Pit1
Library ID: 2002
Organism: Rattus norvegicus
Gender: female
Age: 0
Stage: adult
Organ: pituitary gland
Tissue: pituitary gland
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.23 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).

NIH_MGC_269

Name: NIH_MGC_269
Library ID: 2193
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: neither
Age: 0
Stage: placental
Organ: placenta
Tissue: whole placenta, 2 pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Tissue was collected from two pooled placentas from the 21st day of pregnancy. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.25 kb fragments for an average insert size of 2.05 kb. A normalized version of this library is also available (NIH_MGC_270). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Mammalian Gene Collection library.

NIH_MGC_270

Name: NIH_MGC_270
Library ID: 2194
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: neither
Age: 0
Stage: placental
Organ: placenta
Tissue: whole placenta, 2 pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Tissue was collected from two pooled placentas from the 21st day of pregnancy. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for >1.25 kb fragments for an average insert size of 2.15 kb. Library was normalized to Cot7. A non-normalized version of this library is also available (NIH_MGC_269). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Mammalian Gene Collection library.

NCI_CGAP_Pr29

Name: NCI_CGAP_Pr29
Library ID: 1846
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: dorsolateral prostate, 5 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: dorsolateral prostate from 11-week male rat, 5 days post-conception, average insert size 2.2 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr30

Name: NCI_CGAP_Pr30
Library ID: 1847
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: ventral prostate, 3 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: ventral prostate from 11-week male rat, 3 days post-conception, average insert size 2.0 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr32

Name: NCI_CGAP_Pr32
Library ID: 1850
Organism: Rattus norvegicus
Gender: male
Age: 0
Organ: prostate
Tissue: dorsal prostate
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Constructed by Invitrogen. Note: this is a NCI_CGAP Library.


NCI_CGAP_Pr33

Name: NCI_CGAP_Pr33
Library ID: 1843
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: lateral prostate
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Invitrogen. Note: this is a NCI_CGAP Library.


NCI_CGAP_Pr35

Name: NCI_CGAP_Pr35
Library ID: 1463
Organism: Rattus norvegicus
Gender: male
Age: 0
Organ: prostate
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


NCI_CGAP_Pr39

Name: NCI_CGAP_Pr39
Library ID: 1844
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: dorsolateral prostate, 3 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: dorsolateral from 11-week old male rat, 3 days post-castration. Average insert size 2.7 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr40

Name: NCI_CGAP_Pr40
Library ID: 1848
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: ventral prostate, 5 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: ventral prostate from 11-week male rat, 5 days post-conception, average insert size 1.6 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr41

Name: NCI_CGAP_Pr41
Library ID: 1849
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: ventral prostate, 7 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: ventral prostate from 11-week male rat, 7 days post-conception, average insert size 2.5 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr42

Name: NCI_CGAP_Pr42
Library ID: 1845
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: dorsolateral prostate, 7 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Tissue: dorsolateral prostate from male rat, 7 days post-conception, average insert size 2.2 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr46

Name: NCI_CGAP_Pr46
Library ID: 1841
Organism: Rattus norvegicus
Gender: male
Age: 0
Organ: prostate
Tissue: ventral prostate
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Ventral prostate from 10-week old male rat. Average insert size 2.0 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr47

Name: NCI_CGAP_Pr47
Library ID: 1842
Organism: Rattus norvegicus
Gender: male
Age: 0
Organ: prostate
Tissue: dorsolateral prostate
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Dorsolateral prostate from 10-week old male rat. Average insert size 2.0 kb. Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.

NCI_CGAP_Pr49

Name: NCI_CGAP_Pr49
Library ID: 1828
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: ventral prostate, pool of 3, 5 and 7 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pool of 3 primary libraries: NCI_CGAP_Pr30 (ventral prostate from 11 wk male, 3 days post-castration, average insert size 2 kb), NCI_CGAP_Pr40 (ventral prostate from 11 wk male, 5 days post-castration, average insert size 1.6 kb) and NCI_CGAP_Pr41 (ventral prostate from 11 wk male, 7 days post-castration, average insert size 2.5 kb). Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.


NCI_CGAP_Pr50

Name: NCI_CGAP_Pr50
Library ID: 1829
Organism: Rattus norvegicus
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: dorsolateral prostate, pool of 3, 5 and 7 days post-castration
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pool of 3 primary libraries: NCI_CGAP_Pr39 (dorsolateral prostate from 11 wk male, 3 days post-castration, average insert size 2.7 kb), NCI_CGAP_Pr29 (dorsolateral prostate from 11 wk male, 5 days post-castration, average insert size 2.2 kb) and NCI_CGAP_Pr42 (dorsolateral prostate from 11 wk male, 7 days post-castration, average insert size 2.2 kb). Constructed by Life Technologies/Invitrogen. Note: this is a NCI_CGAP Library.


NCI_CGAP_Pr51

Name: NCI_CGAP_Pr51
Library ID: 1851
Organism: Rattus norvegicus
Gender: male
Age: 0
Organ: prostate
Tissue: dorsolateral and ventral prostate
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pool of 2 primary libraries: NCI_CGAP_Pr46 (ventral prostate from 10 wk male, average insert size 2 kb) and NCI_CGAP_Pr47 (dorsolateral prostate from 10 wk male, average insert size 2 kb). Constructed by Invitrogen. Note: this is a NCI_CGAP Library.


NIH_MGC_248

Name: NIH_MGC_248
Library ID: 2181
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: spleen
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This is a primary library (normalized library is NIH_MGC_249) and was constructed by Open Biosytems. Note: this is a NIH_MGC Library.

NIH_MGC_249

Name: NIH_MGC_249
Library ID: 2182
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: spleen
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.4 kb. This primary library is normalized (primary library is NIH_MGC_248) and was constructed by Open Biosystems (Huntsville, AL). Note: this is a NIH_MGC Library.

NIH_MGC_433

Name: NIH_MGC_433
Library ID: 2489
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: spleen
Tissue: pooled spleens from 97 embryos from 28 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.35kb resulted in an average insert size of 1.8kb. This is a non-normalized primary library (normalized library is NIH_MGC_434) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_434

Name: NIH_MGC_434
Library ID: 2490
Organism: Rattus norvegicus
Strain: BN/Mcwi
Age: 0
Stage: embryo
Organ: spleen
Tissue: pooled spleens from 97 embryos from 28 pregnant females
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.35kb resulted in an average insert size of 1.85kb. This library is normalized to Cot7 (primary library is NIH_MGC_433) and was constructed by Express Genomics (Frederick, MD) for the Mammalian Gene Collection.

NIH_MGC_237

Name: NIH_MGC_237
Library ID: 2126
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 2.4 kb. This primary library is not normalized (normalized primary library is NIH_MGC_238) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_238

Name: NIH_MGC_238
Library ID: 2127
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.4kb resulted in an average insert size of 1.9 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_237) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

NIH_MGC_250

Name: NIH_MGC_250
Library ID: 2183
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: thymus
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.9 kb. This is a primary library (normalized library is NIH_MGC_251) and was constructed by Open Biosystems. Note: this is a NIH_MGC Library.

NIH_MGC_251

Name: NIH_MGC_251
Library ID: 2184
Organism: Rattus norvegicus
Strain: Brown Norway line 3
Gender: both
Age: 0
Stage: juvenile
Organ: thymus
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.6 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_250) and was constructed by Open Biosystems. Note: this is a NIH_MGC library.

horizontal blue line

Home | I.M.A.G.E. | ORFeome | CGAP | MGC | XGC | ZGC | CMLS | Lawrence Livermore | U Iowa | LLNL Disclaimer | HAIB Disclaimer
Web page maintained by
preston.hunter@asu.edu
Email address:
Biological Questions and Comments to
preston.hunter@asu.edu